Mutagenetix > Incidental Mutation

Incidental Mutation 'R3916:Scn1a'

309721

Institutional Source

Beutler Lab

Gene Symbol

Scn1a

Ensembl Gene

ENSMUSG00000064329

Gene Name

sodium channel, voltage-gated, type I, alpha

Synonyms

Nav1.1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66270778-66440840 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66277613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1590 (T1590A)

Ref Sequence

ENSEMBL: ENSMUSP00000107990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]

AlphaFold

A2APX8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077489
AA Change: T1590A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: T1590A

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094951
AA Change: T1573A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: T1573A

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.3e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	691	2e-62	PFAM
Pfam:Ion_trans	774	963	6.7e-47	PFAM
Pfam:Na_trans_assoc	978	1200	1.2e-74	PFAM
Pfam:Ion_trans	1226	1454	1e-56	PFAM
PDB:1BYY\|A	1456	1508	4e-31	PDB
Pfam:Ion_trans	1547	1757	1.1e-51	PFAM
Pfam:PKD_channel	1606	1764	3.8e-7	PFAM
low complexity region	1809	1821	N/A	INTRINSIC
IQ	1886	1908	1.65e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112366
AA Change: T1601A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: T1601A

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	127	434	2.8e-82	PFAM
Pfam:Na_trans_cytopl	502	718	2e-91	PFAM
Pfam:Ion_trans	767	1002	6.5e-57	PFAM
Pfam:Na_trans_assoc	1006	1213	1.2e-60	PFAM
Pfam:Ion_trans	1217	1493	3.3e-67	PFAM
Pfam:Ion_trans	1540	1797	6.3e-56	PFAM
Pfam:PKD_channel	1637	1791	1.1e-6	PFAM
low complexity region	1837	1849	N/A	INTRINSIC
IQ	1914	1936	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112371
AA Change: T1590A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: T1590A

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156865

SMART Domains

Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
Pfam:Na_trans_assoc	1	182	2.2e-44	PFAM
Pfam:Ion_trans	186	462	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200839

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	G	2: 68,731,985	F319V	possibly damaging	Het
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Anks3	A	G	16: 4,947,279	Y423H	probably damaging	Het
Arfgef1	A	T	1: 10,189,443	V600D	probably benign	Het
Arhgef18	T	C	8: 3,454,197	F939L	probably benign	Het
Arhgef2	A	G	3: 88,633,033	N127S	probably damaging	Het
Arid1b	A	G	17: 5,342,653	S2100G	probably benign	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Atrnl1	T	C	19: 57,935,652	V1283A	possibly damaging	Het
Bpifb5	A	C	2: 154,228,181	K184Q	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cant1	A	G	11: 118,408,746	V259A	probably damaging	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Cyp4f18	A	T	8: 71,996,037	F256Y	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dopey1	G	A	9: 86,521,133	R1462H	probably damaging	Het
Dync1i2	A	G	2: 71,249,372	T377A	probably damaging	Het
F2	G	A	2: 91,625,488	T600M	probably damaging	Het
Fam91a1	C	T	15: 58,430,734	H308Y	probably damaging	Het
Fkbp2	C	A	19: 6,978,557		probably null	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Ifi204	T	G	1: 173,755,775	K292N	possibly damaging	Het
Itpkc	A	T	7: 27,228,303	I62N	probably benign	Het
Kcnab1	G	A	3: 65,304,164		probably null	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Larp4	C	T	15: 99,990,403	T107I	probably benign	Het
Lmo7	T	C	14: 101,929,342		probably benign	Het
Lrrc37a	T	C	11: 103,455,518	Y3174C	possibly damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myh7	C	A	14: 54,974,046	E1555D	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Obox3	C	A	7: 15,627,226	C38F	probably benign	Het
P4ha2	A	G	11: 54,126,248	D441G	probably benign	Het
Pcdhb14	A	T	18: 37,448,545	I235F	possibly damaging	Het
Rasgrf2	A	G	13: 92,030,788	V259A	probably damaging	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Sema3b	A	G	9: 107,600,458	F482S	probably damaging	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a3	A	G	13: 73,562,308	I346V	probably benign	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Spns1	A	T	7: 126,371,539		probably null	Het
Supv3l1	T	C	10: 62,449,420	D89G	possibly damaging	Het
Taf1c	G	A	8: 119,600,505	R412W	probably damaging	Het
Tctn3	T	A	19: 40,607,649	T305S	possibly damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tet2	T	C	3: 133,486,055	K873E	possibly damaging	Het
Thada	G	A	17: 84,441,782	A587V	possibly damaging	Het
Tmprss15	T	A	16: 78,985,996	N712Y	probably damaging	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Tnrc6a	A	C	7: 123,181,384	Q1332H	probably damaging	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Uba5	A	T	9: 104,054,190	C227S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc80	T	C	1: 66,677,495	C2925R	probably benign	Het
Vmn2r83	G	A	10: 79,478,910	G331R	probably benign	Het
Xirp2	G	T	2: 67,511,422	V1336F	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het

Other mutations in Scn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Scn1a	APN	2	66335531	critical splice acceptor site	probably null
IGL00650:Scn1a	APN	2	66280793	missense	probably damaging	1.00
IGL00658:Scn1a	APN	2	66286038	missense	probably damaging	1.00
IGL00823:Scn1a	APN	2	66324935	missense	probably benign	0.04
IGL00907:Scn1a	APN	2	66327797	missense	probably damaging	1.00
IGL01339:Scn1a	APN	2	66325960	missense	probably benign	0.09
IGL01401:Scn1a	APN	2	66289111	missense	probably damaging	1.00
IGL01503:Scn1a	APN	2	66322343	missense	probably damaging	1.00
IGL01575:Scn1a	APN	2	66273236	missense	probably damaging	1.00
IGL01598:Scn1a	APN	2	66302485	missense	possibly damaging	0.63
IGL01613:Scn1a	APN	2	66285937	missense	probably damaging	1.00
IGL01796:Scn1a	APN	2	66332301	splice site	probably benign
IGL02079:Scn1a	APN	2	66323360	missense	probably benign	0.14
IGL02171:Scn1a	APN	2	66273199	missense	probably damaging	1.00
IGL02335:Scn1a	APN	2	66277661	missense	possibly damaging	0.93
IGL02406:Scn1a	APN	2	66326036	missense	possibly damaging	0.88
IGL02436:Scn1a	APN	2	66351153	missense	probably benign	0.01
IGL02507:Scn1a	APN	2	66277813	missense	probably damaging	1.00
IGL02646:Scn1a	APN	2	66299618	splice site	probably null
IGL02729:Scn1a	APN	2	66299650	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66324762	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66318077	missense	probably benign	0.00
IGL02752:Scn1a	APN	2	66331412	missense	probably damaging	1.00
IGL02815:Scn1a	APN	2	66324858	missense	probably damaging	1.00
IGL03163:Scn1a	APN	2	66318074	missense	probably benign	0.00
IGL03229:Scn1a	APN	2	66299713	missense	probably damaging	1.00
IGL03286:Scn1a	APN	2	66277576	missense	probably damaging	0.99
IGL03393:Scn1a	APN	2	66318018	missense	probably benign	0.19
BB008:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
BB018:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
PIT4791001:Scn1a	UTSW	2	66273282	missense	probably benign	0.18
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0107:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R0141:Scn1a	UTSW	2	66289062	missense	probably damaging	1.00
R0485:Scn1a	UTSW	2	66273925	missense	probably damaging	0.98
R0517:Scn1a	UTSW	2	66302407	missense	possibly damaging	0.88
R0532:Scn1a	UTSW	2	66317823	missense	probably damaging	1.00
R0746:Scn1a	UTSW	2	66351126	missense	probably benign	0.25
R0755:Scn1a	UTSW	2	66321035	missense	probably damaging	1.00
R0830:Scn1a	UTSW	2	66299784	missense	probably damaging	1.00
R0846:Scn1a	UTSW	2	66324755	missense	probably benign	0.43
R0918:Scn1a	UTSW	2	66323307	splice site	probably null
R1055:Scn1a	UTSW	2	66337996	missense	probably benign	0.08
R1432:Scn1a	UTSW	2	66322429	missense	probably damaging	1.00
R1497:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R1512:Scn1a	UTSW	2	66331285	missense	possibly damaging	0.82
R1525:Scn1a	UTSW	2	66319462	nonsense	probably null
R1567:Scn1a	UTSW	2	66273331	missense	probably damaging	1.00
R1702:Scn1a	UTSW	2	66318223	missense	probably damaging	1.00
R1744:Scn1a	UTSW	2	66322276	missense	probably benign	0.06
R1834:Scn1a	UTSW	2	66324616	missense	probably benign	0.04
R1834:Scn1a	UTSW	2	66324617	missense	probably benign	0.00
R1860:Scn1a	UTSW	2	66317982	missense	probably damaging	0.99
R1871:Scn1a	UTSW	2	66318025	missense	probably damaging	0.98
R1909:Scn1a	UTSW	2	66331352	missense	possibly damaging	0.58
R1967:Scn1a	UTSW	2	66328425	missense	probably damaging	1.00
R1976:Scn1a	UTSW	2	66331271	missense	probably benign	0.02
R2291:Scn1a	UTSW	2	66288968	missense	probably benign	0.44
R2302:Scn1a	UTSW	2	66277745	missense	probably damaging	1.00
R2367:Scn1a	UTSW	2	66327679	missense	probably damaging	1.00
R2418:Scn1a	UTSW	2	66273843	missense	probably damaging	0.98
R2517:Scn1a	UTSW	2	66273832	missense	probably damaging	1.00
R2568:Scn1a	UTSW	2	66273469	missense	probably damaging	1.00
R3083:Scn1a	UTSW	2	66299637	missense	probably damaging	1.00
R3903:Scn1a	UTSW	2	66318132	missense	probably benign	0.08
R3909:Scn1a	UTSW	2	66273988	missense	probably damaging	1.00
R3935:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R3936:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R4043:Scn1a	UTSW	2	66326036	missense	possibly damaging	0.60
R4429:Scn1a	UTSW	2	66350985	missense	possibly damaging	0.77
R4495:Scn1a	UTSW	2	66280802	critical splice acceptor site	probably null
R4662:Scn1a	UTSW	2	66350988	missense	probably benign	0.23
R4834:Scn1a	UTSW	2	66328522	nonsense	probably null
R4873:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R4875:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R5099:Scn1a	UTSW	2	66277801	missense	probably damaging	1.00
R5255:Scn1a	UTSW	2	66277669	missense	probably damaging	0.99
R5435:Scn1a	UTSW	2	66273534	missense	probably damaging	1.00
R5449:Scn1a	UTSW	2	66321002	missense	probably damaging	0.96
R5519:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R5541:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R5556:Scn1a	UTSW	2	66324797	missense	probably benign	0.00
R5587:Scn1a	UTSW	2	66273081	missense	probably benign	0.01
R5972:Scn1a	UTSW	2	66351110	missense	possibly damaging	0.65
R5992:Scn1a	UTSW	2	66335456	missense	probably damaging	1.00
R6195:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6233:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6328:Scn1a	UTSW	2	66273316	missense	probably damaging	1.00
R6417:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6420:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6421:Scn1a	UTSW	2	66272927	missense	probably damaging	1.00
R6461:Scn1a	UTSW	2	66326122	missense	probably null	0.01
R6701:Scn1a	UTSW	2	66337960	missense	probably damaging	0.99
R6717:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R6834:Scn1a	UTSW	2	66327742	missense	probably damaging	1.00
R6918:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R6953:Scn1a	UTSW	2	66319469	missense	probably damaging	1.00
R6996:Scn1a	UTSW	2	66287731	missense	probably damaging	1.00
R7022:Scn1a	UTSW	2	66317899	missense	probably damaging	1.00
R7109:Scn1a	UTSW	2	66350942	missense	possibly damaging	0.62
R7115:Scn1a	UTSW	2	66324618	nonsense	probably null
R7239:Scn1a	UTSW	2	66277656	splice site	probably null
R7434:Scn1a	UTSW	2	66273045	missense	probably benign
R7646:Scn1a	UTSW	2	66287758	missense	possibly damaging	0.93
R7711:Scn1a	UTSW	2	66303660	missense	probably benign
R7879:Scn1a	UTSW	2	66286005	nonsense	probably null
R7931:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
R7962:Scn1a	UTSW	2	66328442	missense	probably damaging	1.00
R8025:Scn1a	UTSW	2	66318213	missense	probably benign	0.02
R8055:Scn1a	UTSW	2	66319501	missense	probably damaging	1.00
R8095:Scn1a	UTSW	2	66302465	missense	possibly damaging	0.93
R8167:Scn1a	UTSW	2	66324838	missense	probably damaging	0.98
R8339:Scn1a	UTSW	2	66286029	missense	probably damaging	1.00
R8363:Scn1a	UTSW	2	66322257	missense	probably damaging	1.00
R8516:Scn1a	UTSW	2	66326134	missense	possibly damaging	0.79
R8559:Scn1a	UTSW	2	66287733	missense	probably damaging	1.00
R8726:Scn1a	UTSW	2	66303639	missense	probably benign
R8733:Scn1a	UTSW	2	66324600	missense	probably benign
R8779:Scn1a	UTSW	2	66350913	critical splice donor site	probably benign
R8841:Scn1a	UTSW	2	66326122	missense	probably benign	0.09
R8916:Scn1a	UTSW	2	66277783	missense	probably damaging	1.00
R8919:Scn1a	UTSW	2	66337986	missense	probably benign	0.16
R9040:Scn1a	UTSW	2	66317901	missense	probably damaging	0.99
R9086:Scn1a	UTSW	2	66351014	missense	probably benign	0.01
R9176:Scn1a	UTSW	2	66273345	missense	probably damaging	1.00
R9228:Scn1a	UTSW	2	66299755	missense	probably benign	0.10
R9275:Scn1a	UTSW	2	66299682	missense	probably damaging	1.00
R9365:Scn1a	UTSW	2	66318121	missense	probably benign	0.10
R9478:Scn1a	UTSW	2	66326149	missense	probably benign	0.01
R9560:Scn1a	UTSW	2	66327787	missense	probably damaging	1.00
R9608:Scn1a	UTSW	2	66322343	missense	probably benign	0.02
R9624:Scn1a	UTSW	2	66323422	missense	probably benign
Z1176:Scn1a	UTSW	2	66326128	missense	possibly damaging	0.92
Z1177:Scn1a	UTSW	2	66324952	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGTATAGAGTGTTTAATCTCAACCACC -3'
(R):5'- GTGTTTGATATCAGCATCATGATCC -3'

Sequencing Primer
(F):5'- GTGTTTAATCTCAACCACCTAAAAGC -3'
(R):5'- ATGATCCTCATCTGTCTGAACATGG -3'

Posted On

2015-04-17