Incidental Mutation 'R3916:4932414N04Rik'
ID309723
Institutional Source Beutler Lab
Gene Symbol 4932414N04Rik
Ensembl Gene ENSMUSG00000079324
Gene NameRIKEN cDNA 4932414N04 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location68656486-68748467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 68731985 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 319 (F319V)
Ref Sequence ENSEMBL: ENSMUSP00000135792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055930
AA Change: F319V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: F319V

DomainStartEndE-ValueType
coiled coil region 154 241 N/A INTRINSIC
Pfam:DUF3496 265 361 8.5e-12 PFAM
internal_repeat_1 456 597 1.76e-26 PROSPERO
internal_repeat_1 601 737 1.76e-26 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000128259
AA Change: F319V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: F319V

DomainStartEndE-ValueType
internal_repeat_1 5 39 6.02e-5 PROSPERO
internal_repeat_1 209 242 6.02e-5 PROSPERO
low complexity region 286 297 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in 4932414N04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4932414N04Rik APN 2 68732875 missense probably benign 0.02
IGL01384:4932414N04Rik APN 2 68745405 missense possibly damaging 0.53
IGL02170:4932414N04Rik APN 2 68731123 missense probably benign 0.02
IGL02650:4932414N04Rik APN 2 68741537 missense probably benign 0.00
IGL02707:4932414N04Rik APN 2 68731130 missense possibly damaging 0.71
IGL02737:4932414N04Rik APN 2 68736560 missense possibly damaging 0.53
IGL03351:4932414N04Rik APN 2 68731083 missense probably benign
R0328:4932414N04Rik UTSW 2 68744280 missense possibly damaging 0.53
R0362:4932414N04Rik UTSW 2 68732917 missense probably benign 0.00
R0638:4932414N04Rik UTSW 2 68717228 missense probably benign 0.18
R1201:4932414N04Rik UTSW 2 68716282 missense possibly damaging 0.53
R1381:4932414N04Rik UTSW 2 68731086 missense probably benign 0.18
R1456:4932414N04Rik UTSW 2 68716214 missense possibly damaging 0.86
R2001:4932414N04Rik UTSW 2 68741456 missense probably benign
R2051:4932414N04Rik UTSW 2 68711048 missense possibly damaging 0.72
R2228:4932414N04Rik UTSW 2 68729591 missense probably benign 0.00
R2292:4932414N04Rik UTSW 2 68732139 missense probably benign 0.00
R2357:4932414N04Rik UTSW 2 68739500 missense possibly damaging 0.86
R2484:4932414N04Rik UTSW 2 68711475 missense possibly damaging 0.85
R3035:4932414N04Rik UTSW 2 68745418 missense probably benign 0.00
R3950:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3951:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3952:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R4091:4932414N04Rik UTSW 2 68745378 missense possibly damaging 0.73
R4118:4932414N04Rik UTSW 2 68736513 missense probably benign
R4153:4932414N04Rik UTSW 2 68668597 intron probably benign
R4210:4932414N04Rik UTSW 2 68659878 start gained probably benign
R4614:4932414N04Rik UTSW 2 68745460 missense probably benign 0.01
R4818:4932414N04Rik UTSW 2 68741466 missense probably benign
R5202:4932414N04Rik UTSW 2 68731964 missense probably benign
R5466:4932414N04Rik UTSW 2 68711389 missense probably benign 0.11
R5585:4932414N04Rik UTSW 2 68741426 missense probably benign 0.00
R5602:4932414N04Rik UTSW 2 68748368 makesense probably null
R5846:4932414N04Rik UTSW 2 68732033 missense unknown
R5902:4932414N04Rik UTSW 2 68708937 start codon destroyed probably null
R6002:4932414N04Rik UTSW 2 68662424 splice site probably null
R6029:4932414N04Rik UTSW 2 68694026 splice site probably null
R6093:4932414N04Rik UTSW 2 68659870 splice site probably benign
R6168:4932414N04Rik UTSW 2 68741483 missense possibly damaging 0.86
R6300:4932414N04Rik UTSW 2 68731109 missense possibly damaging 0.96
R6322:4932414N04Rik UTSW 2 68729499 missense probably benign 0.00
R6533:4932414N04Rik UTSW 2 68716318 nonsense probably null
R6547:4932414N04Rik UTSW 2 68659907 utr 5 prime probably benign
R7309:4932414N04Rik UTSW 2 68716186 missense probably benign 0.29
R7400:4932414N04Rik UTSW 2 68666203 missense unknown
R7454:4932414N04Rik UTSW 2 68688304 missense unknown
R7481:4932414N04Rik UTSW 2 68664231 missense unknown
R7498:4932414N04Rik UTSW 2 68667668 missense unknown
R7523:4932414N04Rik UTSW 2 68662480 missense unknown
R7523:4932414N04Rik UTSW 2 68739329 missense probably benign 0.01
R7583:4932414N04Rik UTSW 2 68739326 missense probably damaging 0.98
R7701:4932414N04Rik UTSW 2 68731204 missense possibly damaging 0.60
R7746:4932414N04Rik UTSW 2 68728995 missense probably benign 0.33
R7778:4932414N04Rik UTSW 2 68739511 missense possibly damaging 0.73
X0025:4932414N04Rik UTSW 2 68729016 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GATCCTGAGCATTTCCACTAGAG -3'
(R):5'- TCCAGGTGGGCTATTATGGAC -3'

Sequencing Primer
(F):5'- GTAGAGGGTATTTCACATGTACTTCC -3'
(R):5'- CTATTATGGACTGATTTGCGGGC -3'
Posted On2015-04-17