Incidental Mutation 'R3916:Dync1i2'
ID 309724
Institutional Source Beutler Lab
Gene Symbol Dync1i2
Ensembl Gene ENSMUSG00000027012
Gene Name dynein cytoplasmic 1 intermediate chain 2
Synonyms 3110079H08Rik, Dncic2
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 71042050-71093647 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71079716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 377 (T377A)
Ref Sequence ENSEMBL: ENSMUSP00000107767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081710] [ENSMUST00000100028] [ENSMUST00000112136] [ENSMUST00000112138] [ENSMUST00000112139] [ENSMUST00000112140] [ENSMUST00000112144] [ENSMUST00000112142]
AlphaFold O88487
Predicted Effect possibly damaging
Transcript: ENSMUST00000081710
AA Change: T377A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080410
Gene: ENSMUSG00000027012
AA Change: T377A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100028
AA Change: T397A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097605
Gene: ENSMUSG00000027012
AA Change: T397A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112136
AA Change: T403A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107764
Gene: ENSMUSG00000027012
AA Change: T403A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 5e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 618 632 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112138
AA Change: T377A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107766
Gene: ENSMUSG00000027012
AA Change: T377A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112139
AA Change: T377A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107767
Gene: ENSMUSG00000027012
AA Change: T377A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 4.5e-21 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 592 606 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112140
AA Change: T403A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107768
Gene: ENSMUSG00000027012
AA Change: T403A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112144
AA Change: T403A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107772
Gene: ENSMUSG00000027012
AA Change: T403A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 133 163 6.5e-19 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112142
AA Change: T397A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107770
Gene: ENSMUSG00000027012
AA Change: T397A

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141619
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit a trend towards slight locomotor deficit. [provided by MGI curators]
Allele List at MGI

All alleles(50) : Targeted, other(2) Gene trapped(48)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Dync1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Dync1i2 APN 2 71,078,299 (GRCm39) splice site probably benign
IGL01609:Dync1i2 APN 2 71,077,352 (GRCm39) splice site probably benign
IGL02479:Dync1i2 APN 2 71,066,323 (GRCm39) missense probably damaging 1.00
IGL02545:Dync1i2 APN 2 71,093,095 (GRCm39) missense possibly damaging 0.95
3-1:Dync1i2 UTSW 2 71,078,172 (GRCm39) missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71,044,828 (GRCm39) missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71,044,828 (GRCm39) missense probably damaging 1.00
R0437:Dync1i2 UTSW 2 71,058,169 (GRCm39) critical splice acceptor site probably null
R0555:Dync1i2 UTSW 2 71,044,862 (GRCm39) frame shift probably null
R0835:Dync1i2 UTSW 2 71,081,316 (GRCm39) missense probably damaging 1.00
R1146:Dync1i2 UTSW 2 71,058,164 (GRCm39) splice site probably benign
R1452:Dync1i2 UTSW 2 71,080,207 (GRCm39) splice site probably benign
R1662:Dync1i2 UTSW 2 71,081,323 (GRCm39) missense possibly damaging 0.87
R1765:Dync1i2 UTSW 2 71,079,759 (GRCm39) missense probably benign
R2059:Dync1i2 UTSW 2 71,080,197 (GRCm39) critical splice donor site probably null
R2145:Dync1i2 UTSW 2 71,044,907 (GRCm39) splice site probably benign
R2233:Dync1i2 UTSW 2 71,079,764 (GRCm39) nonsense probably null
R2234:Dync1i2 UTSW 2 71,079,764 (GRCm39) nonsense probably null
R2235:Dync1i2 UTSW 2 71,079,764 (GRCm39) nonsense probably null
R3151:Dync1i2 UTSW 2 71,064,060 (GRCm39) splice site probably benign
R4653:Dync1i2 UTSW 2 71,078,199 (GRCm39) missense probably damaging 1.00
R4720:Dync1i2 UTSW 2 71,064,018 (GRCm39) missense probably damaging 1.00
R4920:Dync1i2 UTSW 2 71,077,668 (GRCm39) missense probably damaging 1.00
R5574:Dync1i2 UTSW 2 71,063,994 (GRCm39) missense probably benign 0.15
R5620:Dync1i2 UTSW 2 71,088,483 (GRCm39) missense probably benign 0.00
R5677:Dync1i2 UTSW 2 71,058,967 (GRCm39) missense probably benign 0.00
R5711:Dync1i2 UTSW 2 71,081,326 (GRCm39) missense probably benign 0.31
R6730:Dync1i2 UTSW 2 71,077,484 (GRCm39) missense probably benign 0.18
R6911:Dync1i2 UTSW 2 71,077,446 (GRCm39) missense probably benign
R7140:Dync1i2 UTSW 2 71,078,283 (GRCm39) missense probably benign 0.03
R7257:Dync1i2 UTSW 2 71,079,700 (GRCm39) missense possibly damaging 0.92
R7460:Dync1i2 UTSW 2 71,081,230 (GRCm39) missense probably damaging 0.97
R7808:Dync1i2 UTSW 2 71,081,178 (GRCm39) splice site probably null
R8187:Dync1i2 UTSW 2 71,044,865 (GRCm39) missense probably benign 0.13
R9340:Dync1i2 UTSW 2 71,093,019 (GRCm39) missense probably damaging 0.99
Z1176:Dync1i2 UTSW 2 71,078,228 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCTGGCAGGTTAACAAACC -3'
(R):5'- ACCAACTCCATGCTATCCTAGAGG -3'

Sequencing Primer
(F):5'- CTGTTTTGATAGGAATTGGAATACCC -3'
(R):5'- CCTCAGTTAAATGAAAAAGCTTTGG -3'
Posted On 2015-04-17