Incidental Mutation 'R3916:Zbed5'
ID 309733
Institutional Source Beutler Lab
Gene Symbol Zbed5
Ensembl Gene ENSMUSG00000034173
Gene Name zinc finger BED-type containing 5
Synonyms 2410018M08Rik, Chchd2l, Zbed5
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 129924564-129932464 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129931118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 356 (Y356H)
Ref Sequence ENSEMBL: ENSMUSP00000044533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041466] [ENSMUST00000077320] [ENSMUST00000140667]
AlphaFold B2RPU8
Predicted Effect possibly damaging
Transcript: ENSMUST00000041466
AA Change: Y356H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044533
Gene: ENSMUSG00000034173
AA Change: Y356H

DomainStartEndE-ValueType
low complexity region 16 51 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Pfam:DUF4371 281 412 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077320
SMART Domains Protein: ENSMUSP00000116455
Gene: ENSMUSG00000034173

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Pfam:CHCH 95 128 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202430
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Other mutations in Zbed5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Zbed5 APN 5 129,930,974 (GRCm39) splice site probably null
IGL03334:Zbed5 APN 5 129,931,196 (GRCm39) missense possibly damaging 0.66
R0449:Zbed5 UTSW 5 129,930,567 (GRCm39) missense probably damaging 1.00
R0744:Zbed5 UTSW 5 129,931,113 (GRCm39) missense possibly damaging 0.92
R0763:Zbed5 UTSW 5 129,931,020 (GRCm39) missense probably benign 0.00
R1967:Zbed5 UTSW 5 129,930,510 (GRCm39) missense possibly damaging 0.68
R2246:Zbed5 UTSW 5 129,931,592 (GRCm39) missense probably benign 0.01
R2925:Zbed5 UTSW 5 129,932,039 (GRCm39) missense possibly damaging 0.66
R3053:Zbed5 UTSW 5 129,930,987 (GRCm39) missense possibly damaging 0.66
R3701:Zbed5 UTSW 5 129,932,000 (GRCm39) missense possibly damaging 0.90
R3702:Zbed5 UTSW 5 129,932,000 (GRCm39) missense possibly damaging 0.90
R3917:Zbed5 UTSW 5 129,931,118 (GRCm39) missense possibly damaging 0.92
R4547:Zbed5 UTSW 5 129,931,692 (GRCm39) nonsense probably null
R4548:Zbed5 UTSW 5 129,931,692 (GRCm39) nonsense probably null
R5195:Zbed5 UTSW 5 129,931,019 (GRCm39) missense probably benign 0.01
R5500:Zbed5 UTSW 5 129,930,823 (GRCm39) nonsense probably null
R5813:Zbed5 UTSW 5 129,931,059 (GRCm39) missense possibly damaging 0.46
R6377:Zbed5 UTSW 5 129,932,210 (GRCm39) missense possibly damaging 0.83
R6620:Zbed5 UTSW 5 129,932,130 (GRCm39) missense possibly damaging 0.82
R6862:Zbed5 UTSW 5 129,932,026 (GRCm39) missense probably benign
R6931:Zbed5 UTSW 5 129,932,170 (GRCm39) nonsense probably null
R7223:Zbed5 UTSW 5 129,929,279 (GRCm39) missense probably damaging 1.00
R7831:Zbed5 UTSW 5 129,930,798 (GRCm39) missense possibly damaging 0.82
R7918:Zbed5 UTSW 5 129,930,504 (GRCm39) missense possibly damaging 0.46
R7982:Zbed5 UTSW 5 129,929,321 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGGCAGCCGTGGAAACTT -3'
(R):5'- GGAAGTCTTGGGGCAGCG -3'

Sequencing Primer
(F):5'- GCCCTCAGAATTGCCAGAGATATG -3'
(R):5'- ACAATGAGCTCCAATGGCTTTTGG -3'
Posted On 2015-04-17