Mutagenetix > Incidental Mutation

Incidental Mutation 'R3916:Sdk1'

309734

Institutional Source

Beutler Lab

Gene Symbol

Sdk1

Ensembl Gene

ENSMUSG00000039683

Gene Name

sidekick cell adhesion molecule 1

Synonyms

6720466O15Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R3916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141241490-142215586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 142051244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 817 (D817E)

Ref Sequence

ENSEMBL: ENSMUSP00000074133 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]

AlphaFold

Q3UH53

Predicted Effect

probably damaging
Transcript: ENSMUST00000074546
AA Change: D817E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: D817E

Domain	Start	End	E-Value	Type
IGc2	28	91	4.67e-4	SMART
IGc2	121	187	1.45e-9	SMART
IGc2	214	282	1.58e-10	SMART
IG	302	387	1.8e-5	SMART
FN3	390	474	7.39e-14	SMART
FN3	490	576	8.96e-13	SMART
FN3	591	679	1.95e-4	SMART
FN3	694	776	2e-10	SMART
FN3	792	879	4.22e-9	SMART
FN3	896	983	1.41e-10	SMART
FN3	999	1084	2.7e-7	SMART
FN3	1100	1183	1.3e-9	SMART
FN3	1199	1284	2.19e-7	SMART
FN3	1300	1408	5.73e-11	SMART
FN3	1424	1509	1.79e-12	SMART
FN3	1524	1611	1.16e-11	SMART
FN3	1625	1709	1.32e-10	SMART
transmembrane domain	1730	1752	N/A	INTRINSIC
low complexity region	1806	1815	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085774
AA Change: D1077E

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: D1077E

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
IGc2	99	158	2.77e-6	SMART
IG	179	264	3.74e-3	SMART
IGc2	288	351	4.67e-4	SMART
IGc2	381	447	1.45e-9	SMART
IGc2	474	542	1.58e-10	SMART
IG	562	647	1.8e-5	SMART
FN3	650	734	7.39e-14	SMART
FN3	750	836	8.96e-13	SMART
FN3	851	939	1.95e-4	SMART
FN3	954	1036	2e-10	SMART
FN3	1052	1139	4.22e-9	SMART
FN3	1156	1243	1.41e-10	SMART
FN3	1259	1344	2.7e-7	SMART
FN3	1360	1443	1.3e-9	SMART
FN3	1459	1544	2.19e-7	SMART
FN3	1560	1668	5.73e-11	SMART
FN3	1684	1769	1.79e-12	SMART
FN3	1784	1871	1.16e-11	SMART
FN3	1885	1969	1.32e-10	SMART
transmembrane domain	1990	2012	N/A	INTRINSIC
low complexity region	2066	2075	N/A	INTRINSIC
low complexity region	2106	2118	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	G	2: 68,731,985	F319V	possibly damaging	Het
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Anks3	A	G	16: 4,947,279	Y423H	probably damaging	Het
Arfgef1	A	T	1: 10,189,443	V600D	probably benign	Het
Arhgef18	T	C	8: 3,454,197	F939L	probably benign	Het
Arhgef2	A	G	3: 88,633,033	N127S	probably damaging	Het
Arid1b	A	G	17: 5,342,653	S2100G	probably benign	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Atrnl1	T	C	19: 57,935,652	V1283A	possibly damaging	Het
Bpifb5	A	C	2: 154,228,181	K184Q	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cant1	A	G	11: 118,408,746	V259A	probably damaging	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Cyp4f18	A	T	8: 71,996,037	F256Y	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dopey1	G	A	9: 86,521,133	R1462H	probably damaging	Het
Dync1i2	A	G	2: 71,249,372	T377A	probably damaging	Het
F2	G	A	2: 91,625,488	T600M	probably damaging	Het
Fam91a1	C	T	15: 58,430,734	H308Y	probably damaging	Het
Fkbp2	C	A	19: 6,978,557		probably null	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Ifi204	T	G	1: 173,755,775	K292N	possibly damaging	Het
Itpkc	A	T	7: 27,228,303	I62N	probably benign	Het
Kcnab1	G	A	3: 65,304,164		probably null	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Larp4	C	T	15: 99,990,403	T107I	probably benign	Het
Lmo7	T	C	14: 101,929,342		probably benign	Het
Lrrc37a	T	C	11: 103,455,518	Y3174C	possibly damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myh7	C	A	14: 54,974,046	E1555D	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Obox3	C	A	7: 15,627,226	C38F	probably benign	Het
P4ha2	A	G	11: 54,126,248	D441G	probably benign	Het
Pcdhb14	A	T	18: 37,448,545	I235F	possibly damaging	Het
Rasgrf2	A	G	13: 92,030,788	V259A	probably damaging	Het
Scn1a	T	C	2: 66,277,613	T1590A	probably damaging	Het
Sema3b	A	G	9: 107,600,458	F482S	probably damaging	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a3	A	G	13: 73,562,308	I346V	probably benign	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Spns1	A	T	7: 126,371,539		probably null	Het
Supv3l1	T	C	10: 62,449,420	D89G	possibly damaging	Het
Taf1c	G	A	8: 119,600,505	R412W	probably damaging	Het
Tctn3	T	A	19: 40,607,649	T305S	possibly damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tet2	T	C	3: 133,486,055	K873E	possibly damaging	Het
Thada	G	A	17: 84,441,782	A587V	possibly damaging	Het
Tmprss15	T	A	16: 78,985,996	N712Y	probably damaging	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Tnrc6a	A	C	7: 123,181,384	Q1332H	probably damaging	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Uba5	A	T	9: 104,054,190	C227S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc80	T	C	1: 66,677,495	C2925R	probably benign	Het
Vmn2r83	G	A	10: 79,478,910	G331R	probably benign	Het
Xirp2	G	T	2: 67,511,422	V1336F	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het

Other mutations in Sdk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Sdk1	APN	5	142085606	missense	probably damaging	1.00
IGL00945:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL00946:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL01394:Sdk1	APN	5	141613215	missense	probably benign	0.03
IGL01398:Sdk1	APN	5	141937577	missense	probably benign	0.00
IGL01410:Sdk1	APN	5	142212120	missense	probably benign	0.30
IGL01525:Sdk1	APN	5	141999920	missense	probably damaging	1.00
IGL01548:Sdk1	APN	5	142085765	missense	possibly damaging	0.95
IGL01672:Sdk1	APN	5	142185175	missense	probably benign	0.33
IGL01676:Sdk1	APN	5	142127836	missense	probably damaging	0.99
IGL01679:Sdk1	APN	5	142046164	missense	probably benign
IGL01929:Sdk1	APN	5	141953030	missense	probably damaging	0.99
IGL01970:Sdk1	APN	5	142085682	missense	possibly damaging	0.67
IGL02016:Sdk1	APN	5	142034429	missense	possibly damaging	0.85
IGL02060:Sdk1	APN	5	141953012	missense	possibly damaging	0.79
IGL02457:Sdk1	APN	5	141953016	missense	probably damaging	1.00
IGL02634:Sdk1	APN	5	141610032	missense	probably benign	0.01
IGL02637:Sdk1	APN	5	142094572	missense	probably damaging	1.00
IGL02731:Sdk1	APN	5	142172544	missense	probably damaging	1.00
IGL03180:Sdk1	APN	5	142085742	missense	probably damaging	0.96
IGL03259:Sdk1	APN	5	141953033	nonsense	probably null
PIT4453001:Sdk1	UTSW	5	142212038	missense	probably benign	0.00
PIT4544001:Sdk1	UTSW	5	141956232	missense	probably benign	0.08
R0149:Sdk1	UTSW	5	141857054	intron	probably benign
R0173:Sdk1	UTSW	5	142173809	splice site	probably benign
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0242:Sdk1	UTSW	5	142143922	splice site	probably benign
R0245:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0270:Sdk1	UTSW	5	142084566	missense	possibly damaging	0.79
R0398:Sdk1	UTSW	5	141962721	missense	probably benign	0.05
R0401:Sdk1	UTSW	5	142046161	missense	possibly damaging	0.55
R0501:Sdk1	UTSW	5	141937718	missense	probably benign
R0558:Sdk1	UTSW	5	142132065	missense	probably damaging	1.00
R0652:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0834:Sdk1	UTSW	5	141242024	missense	probably benign
R0962:Sdk1	UTSW	5	142161875	missense	probably damaging	1.00
R1424:Sdk1	UTSW	5	142161866	missense	probably damaging	1.00
R1438:Sdk1	UTSW	5	142038323	missense	probably damaging	0.96
R1517:Sdk1	UTSW	5	142127836	missense	probably damaging	0.99
R1519:Sdk1	UTSW	5	141999950	missense	probably benign	0.00
R1539:Sdk1	UTSW	5	142094599	missense	probably damaging	1.00
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1673:Sdk1	UTSW	5	141948506	missense	possibly damaging	0.90
R1686:Sdk1	UTSW	5	142034537	missense	probably benign	0.00
R1806:Sdk1	UTSW	5	141613195	missense	probably damaging	1.00
R1806:Sdk1	UTSW	5	142161926	missense	probably benign
R1925:Sdk1	UTSW	5	142185285	missense	probably benign	0.09
R1956:Sdk1	UTSW	5	142094581	missense	probably damaging	1.00
R1976:Sdk1	UTSW	5	142143818	missense	probably damaging	1.00
R2124:Sdk1	UTSW	5	142185188	missense	possibly damaging	0.70
R2152:Sdk1	UTSW	5	141792944	missense	probably damaging	1.00
R2186:Sdk1	UTSW	5	142046292	missense	probably benign	0.00
R2187:Sdk1	UTSW	5	142114574	missense	probably damaging	1.00
R2306:Sdk1	UTSW	5	141962700	missense	probably benign	0.00
R2520:Sdk1	UTSW	5	142085771	missense	probably benign	0.19
R2698:Sdk1	UTSW	5	142212050	missense	possibly damaging	0.95
R2763:Sdk1	UTSW	5	142084551	missense	possibly damaging	0.90
R3023:Sdk1	UTSW	5	142046236	missense	probably benign
R3500:Sdk1	UTSW	5	142006616	splice site	probably benign
R3613:Sdk1	UTSW	5	142119686	missense	probably damaging	1.00
R3824:Sdk1	UTSW	5	141936049	missense	probably benign
R3917:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R4158:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4160:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4161:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4386:Sdk1	UTSW	5	142094626	missense	probably damaging	0.99
R4649:Sdk1	UTSW	5	142006625	missense	probably damaging	1.00
R4701:Sdk1	UTSW	5	142185231	missense	probably damaging	1.00
R4780:Sdk1	UTSW	5	141959238	missense	probably damaging	0.97
R4787:Sdk1	UTSW	5	141582413	missense	probably benign
R4825:Sdk1	UTSW	5	141582294	missense	probably benign	0.11
R4853:Sdk1	UTSW	5	142146263	missense	probably damaging	1.00
R4857:Sdk1	UTSW	5	142161776	missense	probably benign	0.01
R4928:Sdk1	UTSW	5	141857003	intron	probably benign
R5111:Sdk1	UTSW	5	142127845	missense	probably damaging	1.00
R5188:Sdk1	UTSW	5	141956260	critical splice donor site	probably null
R5246:Sdk1	UTSW	5	142114562	missense	possibly damaging	0.72
R5273:Sdk1	UTSW	5	141998828	missense	probably damaging	0.99
R5484:Sdk1	UTSW	5	142100186	missense	probably damaging	1.00
R5525:Sdk1	UTSW	5	142185265	missense	possibly damaging	0.84
R5578:Sdk1	UTSW	5	141613125	nonsense	probably null
R5593:Sdk1	UTSW	5	141956124	missense	probably damaging	0.98
R5654:Sdk1	UTSW	5	141936098	missense	probably damaging	0.96
R5672:Sdk1	UTSW	5	142188145	missense	possibly damaging	0.94
R5768:Sdk1	UTSW	5	142143871	missense	probably benign	0.00
R5781:Sdk1	UTSW	5	141936048	missense	probably benign	0.00
R5846:Sdk1	UTSW	5	142114393	missense	probably damaging	1.00
R5851:Sdk1	UTSW	5	141962669	missense	probably benign	0.00
R6164:Sdk1	UTSW	5	142132069	missense	probably damaging	1.00
R6235:Sdk1	UTSW	5	142034426	missense	possibly damaging	0.85
R6364:Sdk1	UTSW	5	141962709	missense	probably benign	0.00
R6453:Sdk1	UTSW	5	142096921	missense	probably damaging	1.00
R6892:Sdk1	UTSW	5	142046298	missense	probably benign	0.00
R6996:Sdk1	UTSW	5	142212014	missense	probably benign	0.16
R7003:Sdk1	UTSW	5	142096734	missense	probably benign	0.01
R7022:Sdk1	UTSW	5	142094657	splice site	probably null
R7027:Sdk1	UTSW	5	142096726	splice site	probably null
R7098:Sdk1	UTSW	5	142096870	missense	probably damaging	0.96
R7107:Sdk1	UTSW	5	142081716	missense	probably damaging	0.99
R7203:Sdk1	UTSW	5	142046176	missense	probably benign	0.08
R7313:Sdk1	UTSW	5	141937622	missense	probably damaging	0.97
R7363:Sdk1	UTSW	5	142188142	missense	probably benign	0.05
R7375:Sdk1	UTSW	5	141998843	missense	probably benign	0.01
R7446:Sdk1	UTSW	5	142144976	missense	probably damaging	1.00
R7527:Sdk1	UTSW	5	141792976	missense	possibly damaging	0.61
R7598:Sdk1	UTSW	5	141609998	nonsense	probably null
R7747:Sdk1	UTSW	5	142084491	missense	probably damaging	1.00
R7810:Sdk1	UTSW	5	141937679	missense	probably benign
R7985:Sdk1	UTSW	5	142127847	missense	probably damaging	1.00
R8129:Sdk1	UTSW	5	142191893	missense	probably benign	0.10
R8217:Sdk1	UTSW	5	142211958	missense	possibly damaging	0.81
R8249:Sdk1	UTSW	5	142188015	critical splice acceptor site	probably null
R8376:Sdk1	UTSW	5	142158621	missense	possibly damaging	0.83
R8779:Sdk1	UTSW	5	141962702	missense	probably benign	0.00
R8807:Sdk1	UTSW	5	142085627	missense	probably damaging	1.00
R8907:Sdk1	UTSW	5	142084523	missense	probably damaging	0.99
R8942:Sdk1	UTSW	5	142096843	missense	probably damaging	1.00
R8945:Sdk1	UTSW	5	141613180	missense	probably benign
R9006:Sdk1	UTSW	5	141937566	missense	probably damaging	1.00
R9249:Sdk1	UTSW	5	142143795	missense	probably damaging	1.00
R9275:Sdk1	UTSW	5	141956198	missense	possibly damaging	0.95
R9345:Sdk1	UTSW	5	142161953	missense	probably benign
R9463:Sdk1	UTSW	5	141962793	missense	probably benign	0.31
R9549:Sdk1	UTSW	5	141954902	missense	possibly damaging	0.95
R9572:Sdk1	UTSW	5	141610029	missense	probably damaging	1.00
R9602:Sdk1	UTSW	5	142085598	missense	probably damaging	0.99
R9703:Sdk1	UTSW	5	142114528	missense	possibly damaging	0.95
R9720:Sdk1	UTSW	5	142212041	missense	probably damaging	0.96
R9771:Sdk1	UTSW	5	142096869	missense	probably damaging	0.99
X0017:Sdk1	UTSW	5	141998780	missense	probably benign	0.00
Z1176:Sdk1	UTSW	5	141959310	missense	probably null	0.58
Z1177:Sdk1	UTSW	5	141962708	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AGCTGTTTCTTCCCTGACAG -3'
(R):5'- TCATCTTCATACTGGGAAGCC -3'

Sequencing Primer
(F):5'- TCCCTGACAGTGCTTGGC -3'
(R):5'- GGTAGGAAGACCCACTCTTAATCTG -3'

Posted On

2015-04-17