Incidental Mutation 'R3916:Sdk1'
ID 309734
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Name sidekick cell adhesion molecule 1
Synonyms 6720466O15Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 141241490-142215586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 142051244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 817 (D817E)
Ref Sequence ENSEMBL: ENSMUSP00000074133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
AlphaFold Q3UH53
Predicted Effect probably damaging
Transcript: ENSMUST00000074546
AA Change: D817E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: D817E

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085774
AA Change: D1077E

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: D1077E

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 splice site probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
R7985:Sdk1 UTSW 5 142127847 missense probably damaging 1.00
R8129:Sdk1 UTSW 5 142191893 missense probably benign 0.10
R8217:Sdk1 UTSW 5 142211958 missense possibly damaging 0.81
R8249:Sdk1 UTSW 5 142188015 critical splice acceptor site probably null
R8376:Sdk1 UTSW 5 142158621 missense possibly damaging 0.83
R8779:Sdk1 UTSW 5 141962702 missense probably benign 0.00
R8807:Sdk1 UTSW 5 142085627 missense probably damaging 1.00
R8907:Sdk1 UTSW 5 142084523 missense probably damaging 0.99
R8942:Sdk1 UTSW 5 142096843 missense probably damaging 1.00
R8945:Sdk1 UTSW 5 141613180 missense probably benign
R9006:Sdk1 UTSW 5 141937566 missense probably damaging 1.00
R9249:Sdk1 UTSW 5 142143795 missense probably damaging 1.00
R9275:Sdk1 UTSW 5 141956198 missense possibly damaging 0.95
R9345:Sdk1 UTSW 5 142161953 missense probably benign
R9463:Sdk1 UTSW 5 141962793 missense probably benign 0.31
R9549:Sdk1 UTSW 5 141954902 missense possibly damaging 0.95
R9572:Sdk1 UTSW 5 141610029 missense probably damaging 1.00
R9602:Sdk1 UTSW 5 142085598 missense probably damaging 0.99
R9703:Sdk1 UTSW 5 142114528 missense possibly damaging 0.95
R9720:Sdk1 UTSW 5 142212041 missense probably damaging 0.96
R9771:Sdk1 UTSW 5 142096869 missense probably damaging 0.99
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense probably null 0.58
Z1177:Sdk1 UTSW 5 141962708 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGCTGTTTCTTCCCTGACAG -3'
(R):5'- TCATCTTCATACTGGGAAGCC -3'

Sequencing Primer
(F):5'- TCCCTGACAGTGCTTGGC -3'
(R):5'- GGTAGGAAGACCCACTCTTAATCTG -3'
Posted On 2015-04-17