Incidental Mutation 'R3916:Itpkc'
ID309737
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Nameinositol 1,4,5-trisphosphate 3-kinase C
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R3916 (G1)
Quality Score192
Status Not validated
Chromosome7
Chromosomal Location27207172-27228661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27228303 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 62 (I62N)
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850] [ENSMUST00000003860] [ENSMUST00000108378]
Predicted Effect probably benign
Transcript: ENSMUST00000003850
AA Change: I62N

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: I62N

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003860
SMART Domains Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.9e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108378
SMART Domains Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.4e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206441
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3030:Itpkc UTSW 7 27212308 splice site probably null
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3851:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3852:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3963:Itpkc UTSW 7 27227509 missense probably damaging 1.00
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R7379:Itpkc UTSW 7 27227769 missense probably benign 0.12
R8305:Itpkc UTSW 7 27214519 missense probably damaging 1.00
R8365:Itpkc UTSW 7 27212352 missense probably damaging 1.00
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCCATCTGTCCAGGAACC -3'
(R):5'- CCCCTCGTAGGATTTTAAAGGGG -3'

Sequencing Primer
(F):5'- ATCTCCATCTCAACCAGGGGG -3'
(R):5'- CCTGGGAGCGGGTATGAG -3'
Posted On2015-04-17