Incidental Mutation 'R0381:Trim34b'
List |< first << previous [record 30 of 34] next >> last >|
ID30974
Institutional Source Beutler Lab
Gene Symbol Trim34b
Ensembl Gene ENSMUSG00000090215
Gene Nametripartite motif-containing 34B
SynonymsTrim34-2, Gm15134
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104329471-104336909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104329855 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 103 (L103P)
Ref Sequence ENSEMBL: ENSMUSP00000136926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106847] [ENSMUST00000180136]
Predicted Effect probably damaging
Transcript: ENSMUST00000106847
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215
AA Change: L103P

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180136
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215
AA Change: L103P

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Trim34b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Trim34b APN 7 104329652 nonsense probably null
IGL01103:Trim34b APN 7 104329899 missense probably damaging 1.00
IGL02252:Trim34b APN 7 104329932 missense probably damaging 0.98
IGL03241:Trim34b APN 7 104334613 intron probably benign
R0032:Trim34b UTSW 7 104336577 missense possibly damaging 0.61
R2403:Trim34b UTSW 7 104329669 missense probably benign
R2520:Trim34b UTSW 7 104331239 missense probably damaging 1.00
R2857:Trim34b UTSW 7 104336232 missense probably benign 0.00
R2859:Trim34b UTSW 7 104336232 missense probably benign 0.00
R3077:Trim34b UTSW 7 104331301 missense possibly damaging 0.89
R4094:Trim34b UTSW 7 104334588 missense probably benign
R4449:Trim34b UTSW 7 104335728 missense probably benign 0.00
R5183:Trim34b UTSW 7 104329911 missense possibly damaging 0.92
R5700:Trim34b UTSW 7 104336411 missense probably damaging 1.00
R5759:Trim34b UTSW 7 104331433 missense possibly damaging 0.46
R6236:Trim34b UTSW 7 104336318 missense probably damaging 0.99
R6364:Trim34b UTSW 7 104336526 missense probably damaging 0.99
R7034:Trim34b UTSW 7 104329536 start gained probably benign
R7036:Trim34b UTSW 7 104329536 start gained probably benign
R7237:Trim34b UTSW 7 104329587 missense possibly damaging 0.80
R7392:Trim34b UTSW 7 104336397 missense probably benign 0.00
R7405:Trim34b UTSW 7 104336483 missense probably damaging 1.00
R7516:Trim34b UTSW 7 104329711 missense probably damaging 1.00
R7646:Trim34b UTSW 7 104335352 missense probably damaging 0.97
R7909:Trim34b UTSW 7 104330524 missense probably benign 0.01
R8396:Trim34b UTSW 7 104329876 missense probably damaging 1.00
Z1176:Trim34b UTSW 7 104335314 missense probably damaging 1.00
Z1177:Trim34b UTSW 7 104331353 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCAAGCCTGTCTCATCTCGAACAAG -3'
(R):5'- GCGTTAGGAACCCAGTGGTAATGTG -3'

Sequencing Primer
(F):5'- TCATCTCGAACAAGAATGCAGTG -3'
(R):5'- CCCAGTGGTAATGTGAATCAAG -3'
Posted On2013-04-24