Incidental Mutation 'R3916:Cyp4f18'
ID309744
Institutional Source Beutler Lab
Gene Symbol Cyp4f18
Ensembl Gene ENSMUSG00000003484
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms1810054N16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71988482-72009626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71996037 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 256 (F256Y)
Ref Sequence ENSEMBL: ENSMUSP00000003574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003574]
Predicted Effect probably benign
Transcript: ENSMUST00000003574
AA Change: F256Y

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003574
Gene: ENSMUSG00000003484
AA Change: F256Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 516 2.7e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136878
Predicted Effect probably benign
Transcript: ENSMUST00000141975
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukotriene B4 metabolism but show no significant alterations in inflammatory cell infiltration or injury following renal ischemia-reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Cyp4f18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cyp4f18 APN 8 71989927 missense probably damaging 0.96
IGL01465:Cyp4f18 APN 8 72002444 missense probably benign
IGL01863:Cyp4f18 APN 8 71989926 missense possibly damaging 0.49
IGL02403:Cyp4f18 APN 8 71998228 missense probably damaging 0.97
IGL03244:Cyp4f18 APN 8 71988645 missense probably benign 0.12
R0226:Cyp4f18 UTSW 8 71989775 splice site probably benign
R0310:Cyp4f18 UTSW 8 72001012 splice site probably benign
R0486:Cyp4f18 UTSW 8 71996017 missense probably benign 0.02
R0506:Cyp4f18 UTSW 8 71996000 missense probably benign 0.00
R0547:Cyp4f18 UTSW 8 71996010 missense probably benign 0.00
R0689:Cyp4f18 UTSW 8 71995968 missense probably benign
R0721:Cyp4f18 UTSW 8 72001135 missense probably benign 0.02
R1534:Cyp4f18 UTSW 8 71992955 missense probably damaging 1.00
R2087:Cyp4f18 UTSW 8 72000988 missense probably benign
R2902:Cyp4f18 UTSW 8 72002411 missense probably damaging 0.96
R3149:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3150:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3177:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3277:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3906:Cyp4f18 UTSW 8 72001082 splice site probably benign
R3953:Cyp4f18 UTSW 8 72000957 missense probably damaging 1.00
R4815:Cyp4f18 UTSW 8 71995995 missense possibly damaging 0.52
R4915:Cyp4f18 UTSW 8 72009054 missense probably damaging 1.00
R5086:Cyp4f18 UTSW 8 72002432 missense probably benign 0.00
R5113:Cyp4f18 UTSW 8 71989058 critical splice donor site probably null
R5202:Cyp4f18 UTSW 8 72009096 missense probably benign 0.03
R5761:Cyp4f18 UTSW 8 71996131 missense probably damaging 0.99
R6187:Cyp4f18 UTSW 8 71993186 missense probably damaging 0.98
R6664:Cyp4f18 UTSW 8 71989915 missense probably benign 0.21
R6944:Cyp4f18 UTSW 8 71989894 missense probably benign 0.03
R6978:Cyp4f18 UTSW 8 72002496 missense probably benign
R7288:Cyp4f18 UTSW 8 71993173 missense probably damaging 1.00
R7326:Cyp4f18 UTSW 8 71988654 missense probably benign 0.14
R7432:Cyp4f18 UTSW 8 71996062 missense probably benign 0.00
R7871:Cyp4f18 UTSW 8 71988643 missense possibly damaging 0.69
R8063:Cyp4f18 UTSW 8 71998231 missense probably damaging 1.00
R8272:Cyp4f18 UTSW 8 71989091 missense probably benign 0.44
R8321:Cyp4f18 UTSW 8 71988583 missense possibly damaging 0.88
Z1177:Cyp4f18 UTSW 8 71998283 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTTTAGAAGCCCACCTTGC -3'
(R):5'- CACCTCTATGATACCAATGAGGC -3'

Sequencing Primer
(F):5'- TTAGAAGCCCACCTTGCTCAGC -3'
(R):5'- AAACAGGGTCAGGTTTCCC -3'
Posted On2015-04-17