Incidental Mutation 'R3916:Cd109'
ID309751
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene NameCD109 antigen
SynonymsGov platelet alloantigens, 9930012E15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3916 (G1)
Quality Score217
Status Not validated
Chromosome9
Chromosomal Location78615546-78716253 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78712500 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78616969 missense probably damaging 1.00
IGL00465:Cd109 APN 9 78660934 nonsense probably null
IGL00667:Cd109 APN 9 78684877 missense probably damaging 0.99
IGL01432:Cd109 APN 9 78698123 missense probably benign
IGL01795:Cd109 APN 9 78661765 splice site probably benign
IGL02343:Cd109 APN 9 78688955 splice site probably benign
IGL02450:Cd109 APN 9 78695850 missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78671989 splice site probably benign
IGL02738:Cd109 APN 9 78691299 missense probably damaging 1.00
IGL02797:Cd109 APN 9 78661713 missense probably damaging 0.96
IGL03160:Cd109 APN 9 78661056 splice site probably null
IGL03349:Cd109 APN 9 78636485 missense probably benign 0.34
FR4589:Cd109 UTSW 9 78712529 critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78680021 missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0158:Cd109 UTSW 9 78688932 missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78712615 missense probably benign 0.13
R0659:Cd109 UTSW 9 78680170 splice site probably benign
R0709:Cd109 UTSW 9 78671978 missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78664330 missense probably benign 0.04
R0909:Cd109 UTSW 9 78636473 missense probably benign 0.01
R0945:Cd109 UTSW 9 78688941 missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78672550 critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78654587 missense probably damaging 1.00
R1484:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78705091 missense probably benign 0.17
R1773:Cd109 UTSW 9 78703724 missense probably benign 0.21
R1813:Cd109 UTSW 9 78617005 missense probably benign 0.04
R2004:Cd109 UTSW 9 78703762 missense probably benign 0.00
R2083:Cd109 UTSW 9 78667293 missense probably damaging 1.00
R2483:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R2857:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R3713:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78636463 missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78672589 missense probably benign 0.00
R4723:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78634677 critical splice donor site probably null
R5259:Cd109 UTSW 9 78710152 missense probably benign 0.30
R5353:Cd109 UTSW 9 78710239 missense probably damaging 1.00
R5440:Cd109 UTSW 9 78680164 critical splice donor site probably null
R5559:Cd109 UTSW 9 78660968 missense probably benign 0.01
R5701:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78700279 missense probably benign 0.01
R5997:Cd109 UTSW 9 78705062 missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78698314 splice site probably null
R6174:Cd109 UTSW 9 78665546 critical splice donor site probably null
R6410:Cd109 UTSW 9 78657516 missense probably benign 0.01
R6529:Cd109 UTSW 9 78712625 missense probably damaging 1.00
R6655:Cd109 UTSW 9 78684938 missense probably benign 0.44
R6704:Cd109 UTSW 9 78680075 missense probably benign 0.01
R6772:Cd109 UTSW 9 78680810 missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78714955 missense probably benign 0.01
R6903:Cd109 UTSW 9 78636603 missense probably damaging 0.97
R7294:Cd109 UTSW 9 78712635 missense probably damaging 0.97
R7432:Cd109 UTSW 9 78714943 missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78680837 missense probably damaging 1.00
R7767:Cd109 UTSW 9 78710159 missense probably damaging 1.00
R7986:Cd109 UTSW 9 78688766 missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78664351 missense probably benign 0.28
R8225:Cd109 UTSW 9 78661690 missense probably damaging 0.99
R8269:Cd109 UTSW 9 78665682 missense probably benign 0.06
RF002:Cd109 UTSW 9 78712523 critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78712527 critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78712525 critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78691313 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTTTAGTAGACGGGGACTAAG -3'
(R):5'- AAATGCCTGCCTTGATTCCC -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GCCTTGATTCCCAAAGTCTTAGAAAC -3'
Posted On2015-04-17