Mutagenetix > Incidental Mutation

Incidental Mutation 'R3916:Cd109'

309751

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3916 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78712500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

AlphaFold

Q8R422

Predicted Effect

probably benign
Transcript: ENSMUST00000093812

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	G	2: 68,731,985	F319V	possibly damaging	Het
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Anks3	A	G	16: 4,947,279	Y423H	probably damaging	Het
Arfgef1	A	T	1: 10,189,443	V600D	probably benign	Het
Arhgef18	T	C	8: 3,454,197	F939L	probably benign	Het
Arhgef2	A	G	3: 88,633,033	N127S	probably damaging	Het
Arid1b	A	G	17: 5,342,653	S2100G	probably benign	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Atrnl1	T	C	19: 57,935,652	V1283A	possibly damaging	Het
Bpifb5	A	C	2: 154,228,181	K184Q	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cant1	A	G	11: 118,408,746	V259A	probably damaging	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Cyp4f18	A	T	8: 71,996,037	F256Y	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dopey1	G	A	9: 86,521,133	R1462H	probably damaging	Het
Dync1i2	A	G	2: 71,249,372	T377A	probably damaging	Het
F2	G	A	2: 91,625,488	T600M	probably damaging	Het
Fam91a1	C	T	15: 58,430,734	H308Y	probably damaging	Het
Fkbp2	C	A	19: 6,978,557		probably null	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Ifi204	T	G	1: 173,755,775	K292N	possibly damaging	Het
Itpkc	A	T	7: 27,228,303	I62N	probably benign	Het
Kcnab1	G	A	3: 65,304,164		probably null	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Larp4	C	T	15: 99,990,403	T107I	probably benign	Het
Lmo7	T	C	14: 101,929,342		probably benign	Het
Lrrc37a	T	C	11: 103,455,518	Y3174C	possibly damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myh7	C	A	14: 54,974,046	E1555D	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Obox3	C	A	7: 15,627,226	C38F	probably benign	Het
P4ha2	A	G	11: 54,126,248	D441G	probably benign	Het
Pcdhb14	A	T	18: 37,448,545	I235F	possibly damaging	Het
Rasgrf2	A	G	13: 92,030,788	V259A	probably damaging	Het
Scn1a	T	C	2: 66,277,613	T1590A	probably damaging	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Sema3b	A	G	9: 107,600,458	F482S	probably damaging	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a3	A	G	13: 73,562,308	I346V	probably benign	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Spns1	A	T	7: 126,371,539		probably null	Het
Supv3l1	T	C	10: 62,449,420	D89G	possibly damaging	Het
Taf1c	G	A	8: 119,600,505	R412W	probably damaging	Het
Tctn3	T	A	19: 40,607,649	T305S	possibly damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tet2	T	C	3: 133,486,055	K873E	possibly damaging	Het
Thada	G	A	17: 84,441,782	A587V	possibly damaging	Het
Tmprss15	T	A	16: 78,985,996	N712Y	probably damaging	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Tnrc6a	A	C	7: 123,181,384	Q1332H	probably damaging	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Uba5	A	T	9: 104,054,190	C227S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc80	T	C	1: 66,677,495	C2925R	probably benign	Het
Vmn2r83	G	A	10: 79,478,910	G331R	probably benign	Het
Xirp2	G	T	2: 67,511,422	V1336F	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0659:Cd109	UTSW	9	78680170	splice site	probably benign
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1570:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3772:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6103:Cd109	UTSW	9	78698314	splice site	probably null
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00
R7767:Cd109	UTSW	9	78710159	missense	probably damaging	1.00
R7986:Cd109	UTSW	9	78688766	missense	possibly damaging	0.95
R8017:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8019:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8050:Cd109	UTSW	9	78664351	missense	probably benign	0.28
R8225:Cd109	UTSW	9	78661690	missense	probably damaging	0.99
R8269:Cd109	UTSW	9	78665682	missense	probably benign	0.06
R8479:Cd109	UTSW	9	78667346	nonsense	probably null
R8493:Cd109	UTSW	9	78657519	missense	probably benign	0.41
R8781:Cd109	UTSW	9	78636647	missense	probably damaging	1.00
R8977:Cd109	UTSW	9	78707528	missense	probably benign	0.36
R9051:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R9051:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
R9228:Cd109	UTSW	9	78669760	missense	possibly damaging	0.93
R9366:Cd109	UTSW	9	78714993	missense	probably benign	0.11
R9430:Cd109	UTSW	9	78667416	critical splice donor site	probably null
R9572:Cd109	UTSW	9	78660306	missense	probably benign	0.16
R9691:Cd109	UTSW	9	78703792	missense	possibly damaging	0.94
R9736:Cd109	UTSW	9	78712636	missense	probably damaging	1.00
R9749:Cd109	UTSW	9	78684884	missense	probably damaging	1.00
R9751:Cd109	UTSW	9	78698160	missense	probably damaging	0.99
R9752:Cd109	UTSW	9	78707552	missense	probably benign	0.00
R9789:Cd109	UTSW	9	78634662	missense	possibly damaging	0.90
R9797:Cd109	UTSW	9	78671935	missense	probably benign	0.04
RF002:Cd109	UTSW	9	78712523	critical splice acceptor site	probably benign
RF002:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF003:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF011:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF013:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF047:Cd109	UTSW	9	78712527	critical splice acceptor site	probably benign
RF060:Cd109	UTSW	9	78712525	critical splice acceptor site	probably benign
Z1177:Cd109	UTSW	9	78691313	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCCTTTAGTAGACGGGGACTAAG -3'
(R):5'- AAATGCCTGCCTTGATTCCC -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GCCTTGATTCCCAAAGTCTTAGAAAC -3'

Posted On

2015-04-17