Incidental Mutation 'R3916:Dop1a'
ID 309752
Institutional Source Beutler Lab
Gene Symbol Dop1a
Ensembl Gene ENSMUSG00000034973
Gene Name DOP1 leucine zipper like protein A
Synonyms D9Ertd809e, B130005I07Rik, Dopey1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 86349194-86436683 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86403186 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1462 (R1462H)
Ref Sequence ENSEMBL: ENSMUSP00000140740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185297] [ENSMUST00000185919] [ENSMUST00000190957]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034987
AA Change: R1462H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: R1462H

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185297
SMART Domains Protein: ENSMUSP00000140258
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
low complexity region 111 125 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185919
AA Change: R1460H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: R1460H

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187348
Predicted Effect probably damaging
Transcript: ENSMUST00000190957
AA Change: R1462H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: R1462H

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Meta Mutation Damage Score 0.2417 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Dop1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dop1a APN 9 86,433,732 (GRCm39) missense possibly damaging 0.57
IGL00427:Dop1a APN 9 86,403,552 (GRCm39) missense probably damaging 0.96
IGL00427:Dop1a APN 9 86,403,551 (GRCm39) missense possibly damaging 0.93
IGL00427:Dop1a APN 9 86,403,553 (GRCm39) missense probably benign 0.09
IGL00577:Dop1a APN 9 86,402,999 (GRCm39) missense probably damaging 1.00
IGL00741:Dop1a APN 9 86,404,859 (GRCm39) missense possibly damaging 0.50
IGL00959:Dop1a APN 9 86,369,484 (GRCm39) missense probably damaging 1.00
IGL01339:Dop1a APN 9 86,433,730 (GRCm39) missense possibly damaging 0.90
IGL01608:Dop1a APN 9 86,389,614 (GRCm39) missense probably benign 0.23
IGL01760:Dop1a APN 9 86,401,976 (GRCm39) missense probably benign
IGL01788:Dop1a APN 9 86,413,772 (GRCm39) missense probably benign 0.03
IGL01844:Dop1a APN 9 86,396,138 (GRCm39) missense probably damaging 1.00
IGL01923:Dop1a APN 9 86,404,920 (GRCm39) missense probably damaging 1.00
IGL02036:Dop1a APN 9 86,413,818 (GRCm39) missense probably benign 0.18
IGL02308:Dop1a APN 9 86,402,141 (GRCm39) missense probably damaging 0.98
IGL02494:Dop1a APN 9 86,408,871 (GRCm39) missense probably damaging 1.00
IGL02698:Dop1a APN 9 86,406,412 (GRCm39) splice site probably benign
IGL02731:Dop1a APN 9 86,369,434 (GRCm39) missense probably damaging 1.00
IGL02821:Dop1a APN 9 86,402,209 (GRCm39) missense probably benign
IGL02952:Dop1a APN 9 86,414,975 (GRCm39) splice site probably benign
IGL03071:Dop1a APN 9 86,371,668 (GRCm39) missense possibly damaging 0.91
IGL03271:Dop1a APN 9 86,386,275 (GRCm39) nonsense probably null
IGL03344:Dop1a APN 9 86,418,197 (GRCm39) missense probably damaging 1.00
Beg UTSW 9 86,430,225 (GRCm39) nonsense probably null
covet UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
crave UTSW 9 86,399,092 (GRCm39) missense probably benign
desire UTSW 9 86,402,109 (GRCm39) missense possibly damaging 0.47
groak UTSW 9 86,403,710 (GRCm39) missense probably damaging 1.00
Querer UTSW 9 86,386,265 (GRCm39) missense probably damaging 1.00
yearn UTSW 9 86,386,220 (GRCm39) splice site probably null
R0055:Dop1a UTSW 9 86,394,705 (GRCm39) missense probably benign 0.08
R0285:Dop1a UTSW 9 86,394,692 (GRCm39) missense probably damaging 1.00
R0415:Dop1a UTSW 9 86,388,555 (GRCm39) missense probably damaging 1.00
R0427:Dop1a UTSW 9 86,389,585 (GRCm39) missense probably damaging 1.00
R0514:Dop1a UTSW 9 86,402,787 (GRCm39) missense probably damaging 1.00
R0538:Dop1a UTSW 9 86,367,550 (GRCm39) missense probably damaging 1.00
R1118:Dop1a UTSW 9 86,397,459 (GRCm39) missense probably damaging 1.00
R1158:Dop1a UTSW 9 86,367,609 (GRCm39) missense probably damaging 1.00
R1272:Dop1a UTSW 9 86,403,477 (GRCm39) missense probably damaging 1.00
R1448:Dop1a UTSW 9 86,424,785 (GRCm39) splice site probably null
R1584:Dop1a UTSW 9 86,430,225 (GRCm39) nonsense probably null
R1601:Dop1a UTSW 9 86,418,303 (GRCm39) missense probably damaging 0.99
R1674:Dop1a UTSW 9 86,418,213 (GRCm39) missense probably damaging 0.98
R1706:Dop1a UTSW 9 86,436,133 (GRCm39) missense possibly damaging 0.92
R1856:Dop1a UTSW 9 86,374,057 (GRCm39) missense probably damaging 0.99
R1926:Dop1a UTSW 9 86,405,072 (GRCm39) missense probably damaging 1.00
R1929:Dop1a UTSW 9 86,376,471 (GRCm39) missense probably damaging 1.00
R2029:Dop1a UTSW 9 86,403,418 (GRCm39) missense probably damaging 1.00
R2125:Dop1a UTSW 9 86,403,099 (GRCm39) missense probably damaging 1.00
R2206:Dop1a UTSW 9 86,403,652 (GRCm39) missense probably benign 0.00
R2271:Dop1a UTSW 9 86,376,471 (GRCm39) missense probably damaging 1.00
R2312:Dop1a UTSW 9 86,403,495 (GRCm39) nonsense probably null
R2379:Dop1a UTSW 9 86,403,138 (GRCm39) missense probably damaging 1.00
R2507:Dop1a UTSW 9 86,395,170 (GRCm39) missense probably damaging 1.00
R3737:Dop1a UTSW 9 86,376,486 (GRCm39) missense probably damaging 1.00
R3804:Dop1a UTSW 9 86,403,048 (GRCm39) missense probably damaging 1.00
R3921:Dop1a UTSW 9 86,402,324 (GRCm39) missense probably benign 0.06
R4035:Dop1a UTSW 9 86,376,486 (GRCm39) missense probably damaging 1.00
R4392:Dop1a UTSW 9 86,385,196 (GRCm39) intron probably benign
R4404:Dop1a UTSW 9 86,404,866 (GRCm39) nonsense probably null
R4513:Dop1a UTSW 9 86,402,612 (GRCm39) missense probably benign 0.39
R4624:Dop1a UTSW 9 86,403,578 (GRCm39) missense probably damaging 1.00
R4659:Dop1a UTSW 9 86,384,085 (GRCm39) intron probably benign
R4910:Dop1a UTSW 9 86,374,114 (GRCm39) missense probably damaging 1.00
R4919:Dop1a UTSW 9 86,402,109 (GRCm39) missense possibly damaging 0.47
R5061:Dop1a UTSW 9 86,385,161 (GRCm39) splice site probably benign
R5079:Dop1a UTSW 9 86,369,474 (GRCm39) missense probably damaging 1.00
R5118:Dop1a UTSW 9 86,388,312 (GRCm39) missense probably damaging 1.00
R5169:Dop1a UTSW 9 86,415,074 (GRCm39) missense probably damaging 1.00
R5176:Dop1a UTSW 9 86,403,868 (GRCm39) missense probably damaging 1.00
R5190:Dop1a UTSW 9 86,369,357 (GRCm39) missense probably damaging 1.00
R5256:Dop1a UTSW 9 86,397,381 (GRCm39) missense probably damaging 1.00
R5346:Dop1a UTSW 9 86,402,835 (GRCm39) missense probably damaging 1.00
R5484:Dop1a UTSW 9 86,427,341 (GRCm39) missense probably damaging 1.00
R5501:Dop1a UTSW 9 86,389,783 (GRCm39) missense probably benign 0.04
R5554:Dop1a UTSW 9 86,403,710 (GRCm39) missense probably damaging 1.00
R5707:Dop1a UTSW 9 86,385,050 (GRCm39) missense possibly damaging 0.95
R5826:Dop1a UTSW 9 86,389,623 (GRCm39) missense possibly damaging 0.94
R5921:Dop1a UTSW 9 86,383,975 (GRCm39) missense probably damaging 1.00
R5934:Dop1a UTSW 9 86,424,495 (GRCm39) nonsense probably null
R5936:Dop1a UTSW 9 86,418,565 (GRCm39) nonsense probably null
R6046:Dop1a UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
R6053:Dop1a UTSW 9 86,397,347 (GRCm39) missense possibly damaging 0.95
R6072:Dop1a UTSW 9 86,389,750 (GRCm39) missense probably benign 0.00
R6104:Dop1a UTSW 9 86,402,860 (GRCm39) missense possibly damaging 0.86
R6125:Dop1a UTSW 9 86,403,186 (GRCm39) missense probably damaging 1.00
R6299:Dop1a UTSW 9 86,386,265 (GRCm39) missense probably damaging 1.00
R6930:Dop1a UTSW 9 86,413,825 (GRCm39) critical splice donor site probably null
R6949:Dop1a UTSW 9 86,382,913 (GRCm39) missense probably damaging 1.00
R6979:Dop1a UTSW 9 86,403,695 (GRCm39) missense possibly damaging 0.77
R7035:Dop1a UTSW 9 86,406,355 (GRCm39) missense possibly damaging 0.85
R7069:Dop1a UTSW 9 86,432,222 (GRCm39) critical splice donor site probably null
R7101:Dop1a UTSW 9 86,389,722 (GRCm39) missense probably benign
R7202:Dop1a UTSW 9 86,386,220 (GRCm39) splice site probably null
R7222:Dop1a UTSW 9 86,404,929 (GRCm39) critical splice donor site probably null
R7233:Dop1a UTSW 9 86,403,749 (GRCm39) missense probably benign 0.00
R7236:Dop1a UTSW 9 86,397,431 (GRCm39) missense probably damaging 1.00
R7252:Dop1a UTSW 9 86,382,874 (GRCm39) missense probably damaging 1.00
R7268:Dop1a UTSW 9 86,394,830 (GRCm39) nonsense probably null
R7353:Dop1a UTSW 9 86,394,912 (GRCm39) missense probably damaging 0.99
R7481:Dop1a UTSW 9 86,417,985 (GRCm39) missense probably damaging 1.00
R7498:Dop1a UTSW 9 86,376,464 (GRCm39) missense possibly damaging 0.95
R7507:Dop1a UTSW 9 86,418,002 (GRCm39) missense probably benign 0.01
R7525:Dop1a UTSW 9 86,388,343 (GRCm39) missense probably damaging 1.00
R7539:Dop1a UTSW 9 86,403,626 (GRCm39) missense probably benign 0.03
R7751:Dop1a UTSW 9 86,389,783 (GRCm39) missense probably benign 0.00
R7753:Dop1a UTSW 9 86,371,755 (GRCm39) missense possibly damaging 0.52
R7839:Dop1a UTSW 9 86,424,818 (GRCm39) nonsense probably null
R7868:Dop1a UTSW 9 86,384,037 (GRCm39) critical splice donor site probably null
R8061:Dop1a UTSW 9 86,403,246 (GRCm39) missense possibly damaging 0.95
R8067:Dop1a UTSW 9 86,400,392 (GRCm39) missense probably benign 0.00
R8156:Dop1a UTSW 9 86,376,510 (GRCm39) missense probably damaging 1.00
R8196:Dop1a UTSW 9 86,405,151 (GRCm39) missense probably benign 0.12
R8223:Dop1a UTSW 9 86,400,345 (GRCm39) missense probably damaging 1.00
R8267:Dop1a UTSW 9 86,396,054 (GRCm39) missense possibly damaging 0.81
R8276:Dop1a UTSW 9 86,399,092 (GRCm39) missense probably benign
R8306:Dop1a UTSW 9 86,402,259 (GRCm39) missense possibly damaging 0.94
R8353:Dop1a UTSW 9 86,403,639 (GRCm39) missense probably damaging 0.97
R8362:Dop1a UTSW 9 86,395,941 (GRCm39) missense probably benign 0.02
R8403:Dop1a UTSW 9 86,382,925 (GRCm39) missense probably damaging 1.00
R8817:Dop1a UTSW 9 86,396,003 (GRCm39) missense possibly damaging 0.91
R8862:Dop1a UTSW 9 86,406,404 (GRCm39) critical splice donor site probably null
R8888:Dop1a UTSW 9 86,403,587 (GRCm39) missense probably benign
R8972:Dop1a UTSW 9 86,403,300 (GRCm39) missense possibly damaging 0.50
R9001:Dop1a UTSW 9 86,436,374 (GRCm39) makesense probably null
R9011:Dop1a UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
R9021:Dop1a UTSW 9 86,402,490 (GRCm39) missense probably benign 0.35
R9039:Dop1a UTSW 9 86,382,870 (GRCm39) missense probably damaging 0.99
R9128:Dop1a UTSW 9 86,395,208 (GRCm39) missense probably benign
R9178:Dop1a UTSW 9 86,371,796 (GRCm39) nonsense probably null
R9238:Dop1a UTSW 9 86,415,027 (GRCm39) missense probably benign
R9313:Dop1a UTSW 9 86,406,641 (GRCm39) makesense probably null
R9334:Dop1a UTSW 9 86,403,027 (GRCm39) missense probably damaging 1.00
R9422:Dop1a UTSW 9 86,425,093 (GRCm39) missense probably damaging 1.00
R9562:Dop1a UTSW 9 86,424,811 (GRCm39) missense probably damaging 1.00
R9584:Dop1a UTSW 9 86,385,151 (GRCm39) missense possibly damaging 0.59
R9677:Dop1a UTSW 9 86,425,098 (GRCm39) missense
RF004:Dop1a UTSW 9 86,436,244 (GRCm39) missense probably benign
X0019:Dop1a UTSW 9 86,413,803 (GRCm39) missense probably damaging 0.98
X0019:Dop1a UTSW 9 86,388,280 (GRCm39) missense probably damaging 1.00
ZE80:Dop1a UTSW 9 86,382,895 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCATTGCTTTTGTAAACG -3'
(R):5'- CGCTGAAGATAGACGACAGC -3'

Sequencing Primer
(F):5'- GCTTTTGTAAACGCCATTTCAAC -3'
(R):5'- CTGAACTTTGCACTTAGACAGC -3'
Posted On 2015-04-17