Incidental Mutation 'R3916:Mst1'
ID 309756
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Name macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms D3F15S2h, D9H3F15S2, DNF15S2h, Hgfl
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107957635-107962202 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107961494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 575 (I575V)
Ref Sequence ENSEMBL: ENSMUSP00000125175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162886] [ENSMUST00000162355] [ENSMUST00000193254] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold P26928
Predicted Effect probably benign
Transcript: ENSMUST00000035211
AA Change: I584V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: I584V

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000162886
AA Change: I575V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: I575V

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 107,958,800 (GRCm39) missense probably benign 0.03
IGL01380:Mst1 APN 9 107,961,787 (GRCm39) missense probably damaging 1.00
IGL01420:Mst1 APN 9 107,960,027 (GRCm39) missense probably damaging 0.99
IGL02931:Mst1 APN 9 107,961,841 (GRCm39) splice site probably null
IGL03059:Mst1 APN 9 107,962,012 (GRCm39) missense probably damaging 1.00
IGL03275:Mst1 APN 9 107,961,587 (GRCm39) missense possibly damaging 0.70
R0319:Mst1 UTSW 9 107,959,712 (GRCm39) missense probably benign 0.05
R0361:Mst1 UTSW 9 107,962,096 (GRCm39) missense probably damaging 0.98
R0412:Mst1 UTSW 9 107,960,793 (GRCm39) missense probably benign 0.06
R0569:Mst1 UTSW 9 107,959,500 (GRCm39) missense probably damaging 0.98
R1432:Mst1 UTSW 9 107,961,403 (GRCm39) missense probably benign 0.01
R1483:Mst1 UTSW 9 107,958,849 (GRCm39) missense probably benign 0.03
R1859:Mst1 UTSW 9 107,961,545 (GRCm39) missense probably benign 0.23
R2187:Mst1 UTSW 9 107,961,539 (GRCm39) missense possibly damaging 0.63
R2393:Mst1 UTSW 9 107,960,151 (GRCm39) critical splice donor site probably null
R3522:Mst1 UTSW 9 107,958,702 (GRCm39) unclassified probably benign
R3917:Mst1 UTSW 9 107,961,494 (GRCm39) missense probably benign 0.00
R3945:Mst1 UTSW 9 107,962,052 (GRCm39) missense probably damaging 1.00
R4006:Mst1 UTSW 9 107,960,147 (GRCm39) missense possibly damaging 0.52
R4007:Mst1 UTSW 9 107,960,147 (GRCm39) missense possibly damaging 0.52
R4737:Mst1 UTSW 9 107,957,720 (GRCm39) missense probably benign 0.00
R4756:Mst1 UTSW 9 107,960,826 (GRCm39) missense probably benign 0.28
R5047:Mst1 UTSW 9 107,961,508 (GRCm39) missense probably benign 0.17
R5113:Mst1 UTSW 9 107,959,446 (GRCm39) missense probably damaging 1.00
R5278:Mst1 UTSW 9 107,959,414 (GRCm39) missense probably damaging 0.99
R5279:Mst1 UTSW 9 107,959,414 (GRCm39) missense probably damaging 0.99
R5402:Mst1 UTSW 9 107,961,408 (GRCm39) critical splice donor site probably null
R5677:Mst1 UTSW 9 107,958,485 (GRCm39) missense probably damaging 0.98
R5712:Mst1 UTSW 9 107,960,107 (GRCm39) missense probably damaging 1.00
R6717:Mst1 UTSW 9 107,957,774 (GRCm39) splice site probably null
R7059:Mst1 UTSW 9 107,961,263 (GRCm39) missense probably benign 0.44
R7131:Mst1 UTSW 9 107,962,130 (GRCm39) missense probably null 0.07
R7139:Mst1 UTSW 9 107,960,027 (GRCm39) missense probably damaging 0.99
R7219:Mst1 UTSW 9 107,958,485 (GRCm39) missense probably damaging 0.99
R7501:Mst1 UTSW 9 107,959,748 (GRCm39) missense probably damaging 1.00
R7878:Mst1 UTSW 9 107,961,812 (GRCm39) missense probably benign
R8304:Mst1 UTSW 9 107,958,803 (GRCm39) missense probably benign
R8397:Mst1 UTSW 9 107,958,698 (GRCm39) critical splice donor site probably benign
R8715:Mst1 UTSW 9 107,959,242 (GRCm39) missense possibly damaging 0.95
R9574:Mst1 UTSW 9 107,962,053 (GRCm39) nonsense probably null
R9732:Mst1 UTSW 9 107,959,425 (GRCm39) missense possibly damaging 0.93
X0028:Mst1 UTSW 9 107,959,416 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTAGCAGAGTCTCTTTCTCCCAG -3'
(R):5'- CCTTGAGCCAAAACCAGTGC -3'

Sequencing Primer
(F):5'- CTCTCACAGGATACGAGGTATG -3'
(R):5'- CAGTGCTGGACCTCCCG -3'
Posted On 2015-04-17