Incidental Mutation 'R3916:Vmn2r83'
ID 309759
Institutional Source Beutler Lab
Gene Symbol Vmn2r83
Ensembl Gene ENSMUSG00000091381
Gene Name vomeronasal 2, receptor 83
Synonyms EG625029
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 79304792-79327988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79314744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 331 (G331R)
Ref Sequence ENSEMBL: ENSMUSP00000131426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167976]
AlphaFold E9Q0G7
Predicted Effect probably benign
Transcript: ENSMUST00000167976
AA Change: G331R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131426
Gene: ENSMUSG00000091381
AA Change: G331R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 473 1.5e-33 PFAM
Pfam:NCD3G 516 569 6.2e-22 PFAM
Pfam:7tm_3 602 837 8.1e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Vmn2r83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Vmn2r83 APN 10 79,314,805 (GRCm39) missense probably damaging 1.00
IGL01096:Vmn2r83 APN 10 79,313,662 (GRCm39) missense probably damaging 1.00
IGL01542:Vmn2r83 APN 10 79,314,846 (GRCm39) missense probably benign 0.30
IGL01803:Vmn2r83 APN 10 79,304,894 (GRCm39) missense probably benign 0.01
IGL02110:Vmn2r83 APN 10 79,327,534 (GRCm39) missense possibly damaging 0.82
IGL02347:Vmn2r83 APN 10 79,316,067 (GRCm39) missense possibly damaging 0.75
IGL02417:Vmn2r83 APN 10 79,314,881 (GRCm39) missense probably benign 0.00
IGL02544:Vmn2r83 APN 10 79,317,293 (GRCm39) splice site probably benign
IGL02683:Vmn2r83 APN 10 79,327,115 (GRCm39) missense probably benign
IGL02976:Vmn2r83 APN 10 79,304,832 (GRCm39) missense probably benign 0.00
PIT4378001:Vmn2r83 UTSW 10 79,304,849 (GRCm39) missense probably benign 0.00
PIT4468001:Vmn2r83 UTSW 10 79,313,884 (GRCm39) missense probably damaging 1.00
R0092:Vmn2r83 UTSW 10 79,327,798 (GRCm39) missense probably damaging 1.00
R1391:Vmn2r83 UTSW 10 79,314,931 (GRCm39) missense probably damaging 0.96
R1539:Vmn2r83 UTSW 10 79,327,759 (GRCm39) missense probably damaging 1.00
R1575:Vmn2r83 UTSW 10 79,314,956 (GRCm39) missense probably damaging 0.98
R2033:Vmn2r83 UTSW 10 79,327,653 (GRCm39) missense probably benign 0.03
R3967:Vmn2r83 UTSW 10 79,327,154 (GRCm39) missense probably benign 0.00
R4840:Vmn2r83 UTSW 10 79,313,682 (GRCm39) missense possibly damaging 0.73
R5063:Vmn2r83 UTSW 10 79,314,921 (GRCm39) missense probably benign 0.04
R5630:Vmn2r83 UTSW 10 79,327,785 (GRCm39) missense possibly damaging 0.94
R5707:Vmn2r83 UTSW 10 79,327,183 (GRCm39) missense possibly damaging 0.53
R5980:Vmn2r83 UTSW 10 79,314,626 (GRCm39) missense probably benign 0.04
R6294:Vmn2r83 UTSW 10 79,313,688 (GRCm39) missense probably damaging 0.99
R6302:Vmn2r83 UTSW 10 79,304,837 (GRCm39) missense possibly damaging 0.95
R6769:Vmn2r83 UTSW 10 79,313,856 (GRCm39) missense probably damaging 1.00
R6986:Vmn2r83 UTSW 10 79,316,093 (GRCm39) missense probably benign
R7221:Vmn2r83 UTSW 10 79,316,001 (GRCm39) missense probably benign 0.02
R7376:Vmn2r83 UTSW 10 79,314,790 (GRCm39) missense probably benign 0.00
R7431:Vmn2r83 UTSW 10 79,327,306 (GRCm39) missense probably damaging 0.99
R7501:Vmn2r83 UTSW 10 79,327,771 (GRCm39) missense probably damaging 0.98
R7526:Vmn2r83 UTSW 10 79,327,392 (GRCm39) missense probably damaging 1.00
R7663:Vmn2r83 UTSW 10 79,314,956 (GRCm39) missense probably damaging 0.98
R7881:Vmn2r83 UTSW 10 79,314,261 (GRCm39) missense probably benign 0.01
R7939:Vmn2r83 UTSW 10 79,314,651 (GRCm39) missense probably damaging 1.00
R8314:Vmn2r83 UTSW 10 79,317,313 (GRCm39) missense possibly damaging 0.76
R8364:Vmn2r83 UTSW 10 79,316,037 (GRCm39) missense probably benign 0.12
R8802:Vmn2r83 UTSW 10 79,314,261 (GRCm39) missense probably benign 0.01
R8947:Vmn2r83 UTSW 10 79,304,873 (GRCm39) missense probably benign 0.00
R8969:Vmn2r83 UTSW 10 79,313,853 (GRCm39) missense probably benign 0.15
R8983:Vmn2r83 UTSW 10 79,327,360 (GRCm39) missense probably damaging 1.00
R9018:Vmn2r83 UTSW 10 79,316,020 (GRCm39) missense probably damaging 1.00
R9082:Vmn2r83 UTSW 10 79,304,894 (GRCm39) missense probably benign 0.00
R9390:Vmn2r83 UTSW 10 79,317,322 (GRCm39) nonsense probably null
X0026:Vmn2r83 UTSW 10 79,314,486 (GRCm39) missense probably benign
X0026:Vmn2r83 UTSW 10 79,304,849 (GRCm39) missense probably benign 0.00
Z1176:Vmn2r83 UTSW 10 79,314,756 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGCAAACCCATTATCAGATGC -3'
(R):5'- CTGCATACACAGCATTGTACAC -3'

Sequencing Primer
(F):5'- CAGATGCATATTCTAGAGTCATCAGC -3'
(R):5'- CACAGCATTGTACACATTGTAACTC -3'
Posted On 2015-04-17