Incidental Mutation 'R3916:Vmn2r83'
ID309759
Institutional Source Beutler Lab
Gene Symbol Vmn2r83
Ensembl Gene ENSMUSG00000091381
Gene Namevomeronasal 2, receptor 83
SynonymsEG625029
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79468943-79492154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79478910 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 331 (G331R)
Ref Sequence ENSEMBL: ENSMUSP00000131426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167976]
Predicted Effect probably benign
Transcript: ENSMUST00000167976
AA Change: G331R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131426
Gene: ENSMUSG00000091381
AA Change: G331R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 473 1.5e-33 PFAM
Pfam:NCD3G 516 569 6.2e-22 PFAM
Pfam:7tm_3 602 837 8.1e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Vmn2r83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Vmn2r83 APN 10 79478971 missense probably damaging 1.00
IGL01096:Vmn2r83 APN 10 79477828 missense probably damaging 1.00
IGL01542:Vmn2r83 APN 10 79479012 missense probably benign 0.30
IGL01803:Vmn2r83 APN 10 79469060 missense probably benign 0.01
IGL02110:Vmn2r83 APN 10 79491700 missense possibly damaging 0.82
IGL02347:Vmn2r83 APN 10 79480233 missense possibly damaging 0.75
IGL02417:Vmn2r83 APN 10 79479047 missense probably benign 0.00
IGL02544:Vmn2r83 APN 10 79481459 splice site probably benign
IGL02683:Vmn2r83 APN 10 79491281 missense probably benign
IGL02976:Vmn2r83 APN 10 79468998 missense probably benign 0.00
PIT4378001:Vmn2r83 UTSW 10 79469015 missense probably benign 0.00
PIT4468001:Vmn2r83 UTSW 10 79478050 missense probably damaging 1.00
R0092:Vmn2r83 UTSW 10 79491964 missense probably damaging 1.00
R1391:Vmn2r83 UTSW 10 79479097 missense probably damaging 0.96
R1539:Vmn2r83 UTSW 10 79491925 missense probably damaging 1.00
R1575:Vmn2r83 UTSW 10 79479122 missense probably damaging 0.98
R2033:Vmn2r83 UTSW 10 79491819 missense probably benign 0.03
R3967:Vmn2r83 UTSW 10 79491320 missense probably benign 0.00
R4840:Vmn2r83 UTSW 10 79477848 missense possibly damaging 0.73
R5063:Vmn2r83 UTSW 10 79479087 missense probably benign 0.04
R5630:Vmn2r83 UTSW 10 79491951 missense possibly damaging 0.94
R5707:Vmn2r83 UTSW 10 79491349 missense possibly damaging 0.53
R5980:Vmn2r83 UTSW 10 79478792 missense probably benign 0.04
R6294:Vmn2r83 UTSW 10 79477854 missense probably damaging 0.99
R6302:Vmn2r83 UTSW 10 79469003 missense possibly damaging 0.95
R6769:Vmn2r83 UTSW 10 79478022 missense probably damaging 1.00
R6986:Vmn2r83 UTSW 10 79480259 missense probably benign
R7221:Vmn2r83 UTSW 10 79480167 missense probably benign 0.02
R7376:Vmn2r83 UTSW 10 79478956 missense probably benign 0.00
R7431:Vmn2r83 UTSW 10 79491472 missense probably damaging 0.99
R7501:Vmn2r83 UTSW 10 79491937 missense probably damaging 0.98
R7526:Vmn2r83 UTSW 10 79491558 missense probably damaging 1.00
R7663:Vmn2r83 UTSW 10 79479122 missense probably damaging 0.98
R7881:Vmn2r83 UTSW 10 79478427 missense probably benign 0.01
R7939:Vmn2r83 UTSW 10 79478817 missense probably damaging 1.00
R8314:Vmn2r83 UTSW 10 79481479 missense possibly damaging 0.76
R8364:Vmn2r83 UTSW 10 79480203 missense probably benign 0.12
X0026:Vmn2r83 UTSW 10 79469015 missense probably benign 0.00
X0026:Vmn2r83 UTSW 10 79478652 missense probably benign
Z1176:Vmn2r83 UTSW 10 79478922 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGCAAACCCATTATCAGATGC -3'
(R):5'- CTGCATACACAGCATTGTACAC -3'

Sequencing Primer
(F):5'- CAGATGCATATTCTAGAGTCATCAGC -3'
(R):5'- CACAGCATTGTACACATTGTAACTC -3'
Posted On2015-04-17