Incidental Mutation 'R0381:Mettl24'
ID30976
Institutional Source Beutler Lab
Gene Symbol Mettl24
Ensembl Gene ENSMUSG00000045555
Gene Namemethyltransferase like 24
Synonyms9030224M15Rik
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40683282-40811083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40746390 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 203 (H203N)
Ref Sequence ENSEMBL: ENSMUSP00000049997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058747]
Predicted Effect probably damaging
Transcript: ENSMUST00000058747
AA Change: H203N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049997
Gene: ENSMUSG00000045555
AA Change: H203N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
Pfam:Methyltransf_21 131 328 3.8e-8 PFAM
Pfam:Methyltransf_22 139 344 3.7e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Mettl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Mettl24 APN 10 40810500 missense probably benign 0.05
R0961:Mettl24 UTSW 10 40810619 missense possibly damaging 0.49
R1172:Mettl24 UTSW 10 40737708 missense probably benign 0.01
R1430:Mettl24 UTSW 10 40737795 missense probably damaging 1.00
R1835:Mettl24 UTSW 10 40737816 critical splice donor site probably null
R1940:Mettl24 UTSW 10 40737726 missense probably benign 0.01
R3424:Mettl24 UTSW 10 40683641 nonsense probably null
R4831:Mettl24 UTSW 10 40683417 missense possibly damaging 0.79
R5430:Mettl24 UTSW 10 40737784 missense probably benign 0.07
R5889:Mettl24 UTSW 10 40746490 missense probably benign 0.27
R6893:Mettl24 UTSW 10 40737798 missense probably damaging 1.00
R7072:Mettl24 UTSW 10 40683513 missense probably benign
R7177:Mettl24 UTSW 10 40810512 missense probably damaging 1.00
R7309:Mettl24 UTSW 10 40810500 missense probably benign 0.05
R7898:Mettl24 UTSW 10 40810482 missense probably benign 0.02
X0022:Mettl24 UTSW 10 40746387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGTGAGCTGTTCTACCGTGC -3'
(R):5'- GCCCAAATTCATTCAGAATGCTTCCC -3'

Sequencing Primer
(F):5'- CTCTAGAAGTTAATGgtgtgtgtg -3'
(R):5'- AATGCTTCCCAGTTTTCTGGTG -3'
Posted On2013-04-24