Incidental Mutation 'R3916:Atp1b2'
ID309763
Institutional Source Beutler Lab
Gene Symbol Atp1b2
Ensembl Gene ENSMUSG00000041329
Gene NameATPase, Na+/K+ transporting, beta 2 polypeptide
SynonymsAtpb-2, Amog
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69599736-69605942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69603075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 93 (V93A)
Ref Sequence ENSEMBL: ENSMUSP00000047353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047889] [ENSMUST00000138694]
Predicted Effect probably damaging
Transcript: ENSMUST00000047889
AA Change: V93A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047353
Gene: ENSMUSG00000041329
AA Change: V93A

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 7 283 1.1e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130394
Predicted Effect probably benign
Transcript: ENSMUST00000138694
SMART Domains Protein: ENSMUSP00000116290
Gene: ENSMUSG00000041329

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 130 1.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153198
Meta Mutation Damage Score 0.5147 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 2 subunit. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit lack of motor coordination, tremors, limb paralysis, enlarged ventricles, photoreceptor degeneration, vacuoles adjoining capillaries of brain stem, thalamus, striatum, and spinal cord, and death at 17-18 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Atp1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Atp1b2 APN 11 69605276 missense probably benign 0.30
R0190:Atp1b2 UTSW 11 69601562 missense probably damaging 1.00
R1445:Atp1b2 UTSW 11 69602483 critical splice acceptor site probably null
R1553:Atp1b2 UTSW 11 69602852 missense probably damaging 1.00
R3085:Atp1b2 UTSW 11 69602879 missense possibly damaging 0.58
R3699:Atp1b2 UTSW 11 69605269 missense probably benign 0.09
R3917:Atp1b2 UTSW 11 69603075 missense probably damaging 0.99
R4201:Atp1b2 UTSW 11 69603469 missense possibly damaging 0.65
R4627:Atp1b2 UTSW 11 69601334 missense probably damaging 0.99
R4776:Atp1b2 UTSW 11 69601561 missense probably damaging 1.00
R5115:Atp1b2 UTSW 11 69603473 missense probably damaging 1.00
R5342:Atp1b2 UTSW 11 69602828 missense probably damaging 0.99
R5457:Atp1b2 UTSW 11 69602732 missense probably damaging 1.00
R6618:Atp1b2 UTSW 11 69603463 missense probably damaging 0.97
Z1176:Atp1b2 UTSW 11 69601315 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGACGGCAGACATCATTCTTC -3'
(R):5'- CAGATGCCACAGGAGATTGC -3'

Sequencing Primer
(F):5'- GGCAGACATCATTCTTCTGTGC -3'
(R):5'- AGATTGCTCTCCCAGGAAGG -3'
Posted On2015-04-17