Incidental Mutation 'R3916:Trpv3'
ID309765
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73283734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 309 (D309G)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure
Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049676
AA Change: D309G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: D309G

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Meta Mutation Damage Score 0.4745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
R7434:Trpv3 UTSW 11 73288261 missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73277974 missense probably benign 0.37
R7741:Trpv3 UTSW 11 73288262 missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73286021 missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73277732 missense probably benign 0.43
R8309:Trpv3 UTSW 11 73279921 missense probably damaging 1.00
R8354:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8383:Trpv3 UTSW 11 73289301 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTTCACTGAGCAAAGGGGAG -3'
(R):5'- TCAGAAGTGCACCACGTTTCC -3'

Sequencing Primer
(F):5'- CTGTGATGGCCAGCATCTG -3'
(R):5'- GCACCACGTTTCCCCAGC -3'
Posted On2015-04-17