Incidental Mutation 'R3916:Trpv3'
ID 309765
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Name transient receptor potential cation channel, subfamily V, member 3
Synonyms VRL3, 1110036I10Rik, Nh
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 73158315-73191194 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73174560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 309 (D309G)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
AlphaFold Q8K424
PDB Structure Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049676
AA Change: D309G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: D309G

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Meta Mutation Damage Score 0.4745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73,184,826 (GRCm39) critical splice donor site probably null
IGL01161:Trpv3 APN 11 73,187,544 (GRCm39) splice site probably benign
IGL02130:Trpv3 APN 11 73,170,596 (GRCm39) missense probably benign 0.00
IGL02957:Trpv3 APN 11 73,176,698 (GRCm39) missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73,172,491 (GRCm39) splice site probably benign
R0103:Trpv3 UTSW 11 73,184,805 (GRCm39) missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73,184,805 (GRCm39) missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73,188,013 (GRCm39) missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73,187,640 (GRCm39) splice site probably benign
R0969:Trpv3 UTSW 11 73,169,764 (GRCm39) nonsense probably null
R1748:Trpv3 UTSW 11 73,186,209 (GRCm39) missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73,174,514 (GRCm39) missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73,170,653 (GRCm39) missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73,176,767 (GRCm39) missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73,176,767 (GRCm39) missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73,176,767 (GRCm39) missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73,186,281 (GRCm39) missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73,169,780 (GRCm39) missense probably benign
R3917:Trpv3 UTSW 11 73,174,560 (GRCm39) missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73,178,246 (GRCm39) nonsense probably null
R4242:Trpv3 UTSW 11 73,168,649 (GRCm39) missense probably benign 0.43
R4277:Trpv3 UTSW 11 73,187,264 (GRCm39) missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73,186,150 (GRCm39) missense probably benign 0.40
R4629:Trpv3 UTSW 11 73,172,615 (GRCm39) missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73,186,240 (GRCm39) missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73,186,149 (GRCm39) missense probably benign 0.00
R5121:Trpv3 UTSW 11 73,168,660 (GRCm39) critical splice donor site probably null
R6113:Trpv3 UTSW 11 73,176,844 (GRCm39) missense probably benign 0.10
R6130:Trpv3 UTSW 11 73,187,309 (GRCm39) missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73,174,689 (GRCm39) missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73,182,519 (GRCm39) missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73,168,818 (GRCm39) missense probably benign
R7434:Trpv3 UTSW 11 73,179,087 (GRCm39) missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73,168,800 (GRCm39) missense probably benign 0.37
R7741:Trpv3 UTSW 11 73,179,088 (GRCm39) missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73,176,847 (GRCm39) missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73,168,558 (GRCm39) missense probably benign 0.43
R8309:Trpv3 UTSW 11 73,170,747 (GRCm39) missense probably damaging 1.00
R8354:Trpv3 UTSW 11 73,182,448 (GRCm39) missense probably damaging 1.00
R8383:Trpv3 UTSW 11 73,180,127 (GRCm39) missense probably benign 0.30
R8443:Trpv3 UTSW 11 73,186,209 (GRCm39) missense possibly damaging 0.84
R8454:Trpv3 UTSW 11 73,182,448 (GRCm39) missense probably damaging 1.00
R8492:Trpv3 UTSW 11 73,179,035 (GRCm39) nonsense probably null
R8556:Trpv3 UTSW 11 73,178,291 (GRCm39) missense probably benign
R8701:Trpv3 UTSW 11 73,169,762 (GRCm39) missense possibly damaging 0.84
R9046:Trpv3 UTSW 11 73,176,698 (GRCm39) missense probably damaging 1.00
R9431:Trpv3 UTSW 11 73,178,225 (GRCm39) missense probably benign
R9492:Trpv3 UTSW 11 73,187,267 (GRCm39) missense probably damaging 0.99
R9748:Trpv3 UTSW 11 73,174,499 (GRCm39) missense possibly damaging 0.84
Z1186:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1186:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1186:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1187:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1187:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1187:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1188:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1188:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1188:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1189:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1189:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1189:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1190:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1190:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1190:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1191:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1191:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1191:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Z1192:Trpv3 UTSW 11 73,174,502 (GRCm39) missense probably benign
Z1192:Trpv3 UTSW 11 73,169,803 (GRCm39) missense probably benign
Z1192:Trpv3 UTSW 11 73,160,513 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCACTGAGCAAAGGGGAG -3'
(R):5'- TCAGAAGTGCACCACGTTTCC -3'

Sequencing Primer
(F):5'- CTGTGATGGCCAGCATCTG -3'
(R):5'- GCACCACGTTTCCCCAGC -3'
Posted On 2015-04-17