Incidental Mutation 'R3916:Ddx41'
ID 309769
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene Name DEAD box helicase 41
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, 2900024F02Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 55678223-55684471 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55682293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 205 (R205W)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
AlphaFold Q91VN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000021956
AA Change: R194W

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: R194W

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: R205W

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Myh7 C A 14: 55,211,503 (GRCm39) E1555D probably damaging Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55,679,212 (GRCm39) missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55,680,280 (GRCm39) missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55,680,170 (GRCm39) missense probably benign 0.04
R0081:Ddx41 UTSW 13 55,683,193 (GRCm39) missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55,683,691 (GRCm39) splice site probably benign
R0412:Ddx41 UTSW 13 55,678,421 (GRCm39) missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55,680,819 (GRCm39) missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55,679,112 (GRCm39) splice site probably benign
R1330:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R1812:Ddx41 UTSW 13 55,683,767 (GRCm39) missense probably benign 0.03
R2011:Ddx41 UTSW 13 55,681,906 (GRCm39) splice site probably null
R2224:Ddx41 UTSW 13 55,679,214 (GRCm39) missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55,682,113 (GRCm39) missense probably benign 0.03
R2983:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55,679,083 (GRCm39) missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55,680,957 (GRCm39) missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55,683,834 (GRCm39) missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55,679,868 (GRCm39) missense probably benign 0.02
R4837:Ddx41 UTSW 13 55,679,461 (GRCm39) missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55,683,104 (GRCm39) missense probably benign 0.00
R5642:Ddx41 UTSW 13 55,683,708 (GRCm39) missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55,682,112 (GRCm39) missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55,679,874 (GRCm39) missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55,681,781 (GRCm39) missense probably benign 0.00
R6035:Ddx41 UTSW 13 55,681,781 (GRCm39) missense probably benign 0.00
R7254:Ddx41 UTSW 13 55,681,769 (GRCm39) nonsense probably null
R7640:Ddx41 UTSW 13 55,682,052 (GRCm39) missense possibly damaging 0.81
R7803:Ddx41 UTSW 13 55,679,734 (GRCm39) missense probably damaging 1.00
R8690:Ddx41 UTSW 13 55,680,939 (GRCm39) missense probably damaging 1.00
R8714:Ddx41 UTSW 13 55,682,250 (GRCm39) missense probably damaging 1.00
R9071:Ddx41 UTSW 13 55,680,219 (GRCm39) missense probably damaging 0.96
R9089:Ddx41 UTSW 13 55,683,424 (GRCm39) missense probably benign 0.05
R9312:Ddx41 UTSW 13 55,683,842 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAATACCAGTGTCTTGCC -3'
(R):5'- TCTGCTTCAACAGAGCTTCC -3'

Sequencing Primer
(F):5'- AATGCCGATCATGTCCCG -3'
(R):5'- TTCCATGAGAACTTAGGCCCAGTG -3'
Posted On 2015-04-17