Incidental Mutation 'R0381:BC048403'
ID30977
Institutional Source Beutler Lab
Gene Symbol BC048403
Ensembl Gene ENSMUSG00000053684
Gene NamecDNA sequence BC048403
Synonyms
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location121739937-121752878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121745375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 94 (Y94H)
Ref Sequence ENSEMBL: ENSMUSP00000070834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065600] [ENSMUST00000136432]
PDB Structure
X-ray structure of a hypothetical protein from Mouse Mm.209172 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000065600
AA Change: Y94H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070834
Gene: ENSMUSG00000053684
AA Change: Y94H

DomainStartEndE-ValueType
Pfam:DUF2003 7 444 3.8e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136432
SMART Domains Protein: ENSMUSP00000117249
Gene: ENSMUSG00000053684

DomainStartEndE-ValueType
Pfam:DUF2003 1 309 1.1e-205 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in BC048403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:BC048403 APN 10 121750770 missense probably damaging 1.00
IGL02598:BC048403 APN 10 121739971 utr 5 prime probably benign
IGL02747:BC048403 APN 10 121745550 missense possibly damaging 0.94
R0732:BC048403 UTSW 10 121750947 missense possibly damaging 0.55
R2383:BC048403 UTSW 10 121750649 missense possibly damaging 0.69
R4299:BC048403 UTSW 10 121745446 missense probably benign 0.01
R4760:BC048403 UTSW 10 121740007 missense probably damaging 1.00
R5595:BC048403 UTSW 10 121740147 start gained probably benign
R6184:BC048403 UTSW 10 121750905 missense probably damaging 1.00
R6487:BC048403 UTSW 10 121745541 missense probably damaging 1.00
R6977:BC048403 UTSW 10 121745466 missense probably damaging 0.98
R7094:BC048403 UTSW 10 121740193 missense possibly damaging 0.95
R7250:BC048403 UTSW 10 121745471 missense possibly damaging 0.82
R8186:BC048403 UTSW 10 121745342 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCAGGTCTAGCCTCACACTGATG -3'
(R):5'- ATCCAAGGTGCTGACCAGCTCTTC -3'

Sequencing Primer
(F):5'- AGCCTCACACTGATGACTTTGTAG -3'
(R):5'- CAGCTCTTCTGTGTTGATGAAC -3'
Posted On2013-04-24