Incidental Mutation 'R3916:Slc6a3'
ID 309770
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Name solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Synonyms Dat1, DAT
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 73536747-73578672 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73562308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 346 (I346V)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
AlphaFold Q61327
Predicted Effect probably benign
Transcript: ENSMUST00000022100
AA Change: I346V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: I346V

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8282:Slc6a3 UTSW 13 73557081 missense probably benign 0.01
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
R8446:Slc6a3 UTSW 13 73571555 missense possibly damaging 0.67
R8979:Slc6a3 UTSW 13 73567601 missense probably benign 0.20
R9051:Slc6a3 UTSW 13 73569912 nonsense probably null
R9377:Slc6a3 UTSW 13 73544847 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAGACAGGTTCTCCCAGCCATAG -3'
(R):5'- TTGCTCTCGTTTGAGTCAGC -3'

Sequencing Primer
(F):5'- GCCATAGGCGCTTTGATAGTG -3'
(R):5'- TGAGTCAGCAGTTCTTAAACCC -3'
Posted On 2015-04-17