Mutagenetix > Incidental Mutations

Incidental Mutation 'R3916:Rasgrf2'

309771

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R3916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92030788 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 259 (V259A)

Ref Sequence

ENSEMBL: ENSMUSP00000116203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]

AlphaFold

P70392

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099326
AA Change: V259A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: V259A

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146492
AA Change: V259A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: V259A

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
Pfam:RhoGEF	247	387	1.2e-24	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000149630
AA Change: V39A

SMART Domains

Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708
AA Change: V39A

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	28	168	4.3e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216219
AA Change: V259A

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	G	2: 68,731,985	F319V	possibly damaging	Het
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Anks3	A	G	16: 4,947,279	Y423H	probably damaging	Het
Arfgef1	A	T	1: 10,189,443	V600D	probably benign	Het
Arhgef18	T	C	8: 3,454,197	F939L	probably benign	Het
Arhgef2	A	G	3: 88,633,033	N127S	probably damaging	Het
Arid1b	A	G	17: 5,342,653	S2100G	probably benign	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Atrnl1	T	C	19: 57,935,652	V1283A	possibly damaging	Het
Bpifb5	A	C	2: 154,228,181	K184Q	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cant1	A	G	11: 118,408,746	V259A	probably damaging	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Cyp4f18	A	T	8: 71,996,037	F256Y	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Dopey1	G	A	9: 86,521,133	R1462H	probably damaging	Het
Dync1i2	A	G	2: 71,249,372	T377A	probably damaging	Het
F2	G	A	2: 91,625,488	T600M	probably damaging	Het
Fam91a1	C	T	15: 58,430,734	H308Y	probably damaging	Het
Fkbp2	C	A	19: 6,978,557		probably null	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Ifi204	T	G	1: 173,755,775	K292N	possibly damaging	Het
Itpkc	A	T	7: 27,228,303	I62N	probably benign	Het
Kcnab1	G	A	3: 65,304,164		probably null	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Larp4	C	T	15: 99,990,403	T107I	probably benign	Het
Lmo7	T	C	14: 101,929,342		probably benign	Het
Lrrc37a	T	C	11: 103,455,518	Y3174C	possibly damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myh7	C	A	14: 54,974,046	E1555D	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Obox3	C	A	7: 15,627,226	C38F	probably benign	Het
P4ha2	A	G	11: 54,126,248	D441G	probably benign	Het
Pcdhb14	A	T	18: 37,448,545	I235F	possibly damaging	Het
Scn1a	T	C	2: 66,277,613	T1590A	probably damaging	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Sema3b	A	G	9: 107,600,458	F482S	probably damaging	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a3	A	G	13: 73,562,308	I346V	probably benign	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Spns1	A	T	7: 126,371,539		probably null	Het
Supv3l1	T	C	10: 62,449,420	D89G	possibly damaging	Het
Taf1c	G	A	8: 119,600,505	R412W	probably damaging	Het
Tctn3	T	A	19: 40,607,649	T305S	possibly damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tet2	T	C	3: 133,486,055	K873E	possibly damaging	Het
Thada	G	A	17: 84,441,782	A587V	possibly damaging	Het
Tmprss15	T	A	16: 78,985,996	N712Y	probably damaging	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Tnrc6a	A	C	7: 123,181,384	Q1332H	probably damaging	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Uba5	A	T	9: 104,054,190	C227S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Unc80	T	C	1: 66,677,495	C2925R	probably benign	Het
Vmn2r83	G	A	10: 79,478,910	G331R	probably benign	Het
Xirp2	G	T	2: 67,511,422	V1336F	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTTTCAGACTACAGGAGGGACAC -3'
(R):5'- CTTGCTTCCGGTTTCAGAAAG -3'

Sequencing Primer
(F):5'- CTACAGGAGGGACACTTTCAAG -3'
(R):5'- TCAGAAAGCCGGTTTCATCG -3'

Posted On

2015-04-17