Incidental Mutation 'R3916:Myh7'
ID 309773
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Name myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms beta-MHC, MyHC-I, MYH-beta/slow, betaMHC, Myhcb, Myhc-b, B-MHC
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R3916 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55208141-55232083 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55211503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1555 (E1555D)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085949] [ENSMUST00000102803] [ENSMUST00000168485]
AlphaFold Q91Z83
Predicted Effect probably benign
Transcript: ENSMUST00000085949
Predicted Effect probably damaging
Transcript: ENSMUST00000102803
AA Change: E1555D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: E1555D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104735
Predicted Effect probably damaging
Transcript: ENSMUST00000168485
AA Change: E1555D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: E1555D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181782
SMART Domains Protein: ENSMUSP00000137786
Gene: ENSMUSG00000097652

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 44 94 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227401
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,562,329 (GRCm39) F319V possibly damaging Het
Acad12 A G 5: 121,737,277 (GRCm39) V498A probably damaging Het
Adam19 A G 11: 45,951,762 (GRCm39) E37G probably benign Het
Anks3 A G 16: 4,765,143 (GRCm39) Y423H probably damaging Het
Arfgef1 A T 1: 10,259,668 (GRCm39) V600D probably benign Het
Arhgef18 T C 8: 3,504,197 (GRCm39) F939L probably benign Het
Arhgef2 A G 3: 88,540,340 (GRCm39) N127S probably damaging Het
Arid1b A G 17: 5,392,928 (GRCm39) S2100G probably benign Het
Atp1b2 A G 11: 69,493,901 (GRCm39) V93A probably damaging Het
Atrnl1 T C 19: 57,924,084 (GRCm39) V1283A possibly damaging Het
Bpifb5 A C 2: 154,070,101 (GRCm39) K184Q probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cant1 A G 11: 118,299,572 (GRCm39) V259A probably damaging Het
Ccdc89 A G 7: 90,076,033 (GRCm39) D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cntnap4 C G 8: 113,602,165 (GRCm39) P1190A probably benign Het
Colgalt2 T A 1: 152,384,362 (GRCm39) Y567* probably null Het
Cyp4f18 A T 8: 72,749,881 (GRCm39) F256Y probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Dop1a G A 9: 86,403,186 (GRCm39) R1462H probably damaging Het
Dync1i2 A G 2: 71,079,716 (GRCm39) T377A probably damaging Het
F2 G A 2: 91,455,833 (GRCm39) T600M probably damaging Het
Fam91a1 C T 15: 58,302,583 (GRCm39) H308Y probably damaging Het
Fkbp2 C A 19: 6,955,925 (GRCm39) probably null Het
Gabarapl2 T A 8: 112,679,028 (GRCm39) F115L probably benign Het
Heatr3 T G 8: 88,876,999 (GRCm39) probably null Het
Ifi204 T G 1: 173,583,341 (GRCm39) K292N possibly damaging Het
Itpkc A T 7: 26,927,728 (GRCm39) I62N probably benign Het
Kcnab1 G A 3: 65,211,585 (GRCm39) probably null Het
Krt88 G A 15: 101,350,809 (GRCm39) probably null Het
Larp4 C T 15: 99,888,284 (GRCm39) T107I probably benign Het
Lmo7 T C 14: 102,166,778 (GRCm39) probably benign Het
Lrrc37a T C 11: 103,346,344 (GRCm39) Y3174C possibly damaging Het
Lyzl4 T A 9: 121,412,101 (GRCm39) D105V probably damaging Het
Mst1 A G 9: 107,961,494 (GRCm39) I575V probably benign Het
Nwd1 T A 8: 73,394,439 (GRCm39) C608* probably null Het
Obox3 C A 7: 15,361,151 (GRCm39) C38F probably benign Het
P4ha2 A G 11: 54,017,074 (GRCm39) D441G probably benign Het
Pcdhb14 A T 18: 37,581,598 (GRCm39) I235F possibly damaging Het
Rasgrf2 A G 13: 92,167,296 (GRCm39) V259A probably damaging Het
Scn1a T C 2: 66,107,957 (GRCm39) T1590A probably damaging Het
Sdk1 T A 5: 142,036,999 (GRCm39) D817E probably damaging Het
Sema3b A G 9: 107,477,657 (GRCm39) F482S probably damaging Het
Slc35a5 G C 16: 44,978,521 (GRCm39) probably benign Het
Slc6a3 A G 13: 73,710,427 (GRCm39) I346V probably benign Het
Slu7 G T 11: 43,331,511 (GRCm39) probably null Het
Spns1 A T 7: 125,970,711 (GRCm39) probably null Het
Supv3l1 T C 10: 62,285,199 (GRCm39) D89G possibly damaging Het
Taf1c G A 8: 120,327,244 (GRCm39) R412W probably damaging Het
Tctn3 T A 19: 40,596,093 (GRCm39) T305S possibly damaging Het
Tekt1 A G 11: 72,236,574 (GRCm39) I296T possibly damaging Het
Tet2 T C 3: 133,191,816 (GRCm39) K873E possibly damaging Het
Thada G A 17: 84,749,210 (GRCm39) A587V possibly damaging Het
Tmprss15 T A 16: 78,782,884 (GRCm39) N712Y probably damaging Het
Tnks A G 8: 35,320,515 (GRCm39) S719P probably damaging Het
Tnrc6a A C 7: 122,780,607 (GRCm39) Q1332H probably damaging Het
Trpv3 A G 11: 73,174,560 (GRCm39) D309G possibly damaging Het
Tti2 A G 8: 31,643,547 (GRCm39) K221E possibly damaging Het
Uba5 A T 9: 103,931,389 (GRCm39) C227S probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Unc80 T C 1: 66,716,654 (GRCm39) C2925R probably benign Het
Vmn2r83 G A 10: 79,314,744 (GRCm39) G331R probably benign Het
Xirp2 G T 2: 67,341,766 (GRCm39) V1336F probably benign Het
Zbed5 T C 5: 129,931,118 (GRCm39) Y356H possibly damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 55,224,845 (GRCm39) missense probably damaging 1.00
IGL01025:Myh7 APN 14 55,216,994 (GRCm39) missense probably damaging 1.00
IGL01092:Myh7 APN 14 55,209,089 (GRCm39) missense possibly damaging 0.91
IGL01384:Myh7 APN 14 55,208,916 (GRCm39) missense probably damaging 1.00
IGL01457:Myh7 APN 14 55,226,336 (GRCm39) missense possibly damaging 0.66
IGL01671:Myh7 APN 14 55,210,381 (GRCm39) missense probably damaging 1.00
IGL01923:Myh7 APN 14 55,222,916 (GRCm39) critical splice donor site probably null
IGL02183:Myh7 APN 14 55,212,188 (GRCm39) missense probably benign
IGL02379:Myh7 APN 14 55,216,925 (GRCm39) missense probably damaging 1.00
IGL02884:Myh7 APN 14 55,230,276 (GRCm39) missense probably benign 0.26
IGL02898:Myh7 APN 14 55,221,197 (GRCm39) missense probably damaging 1.00
IGL03027:Myh7 APN 14 55,221,007 (GRCm39) missense probably damaging 1.00
IGL03061:Myh7 APN 14 55,228,661 (GRCm39) unclassified probably benign
IGL03145:Myh7 APN 14 55,220,802 (GRCm39) missense probably damaging 1.00
IGL03250:Myh7 APN 14 55,229,704 (GRCm39) missense probably damaging 1.00
IGL03394:Myh7 APN 14 55,212,818 (GRCm39) missense probably damaging 1.00
BB008:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
BB018:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
R0019:Myh7 UTSW 14 55,221,191 (GRCm39) missense possibly damaging 0.91
R0030:Myh7 UTSW 14 55,229,427 (GRCm39) missense probably benign 0.00
R0183:Myh7 UTSW 14 55,216,333 (GRCm39) missense probably benign 0.02
R0230:Myh7 UTSW 14 55,211,390 (GRCm39) missense probably benign 0.03
R0295:Myh7 UTSW 14 55,222,278 (GRCm39) splice site probably benign
R0423:Myh7 UTSW 14 55,216,646 (GRCm39) missense probably benign 0.06
R0537:Myh7 UTSW 14 55,228,256 (GRCm39) missense possibly damaging 0.81
R0541:Myh7 UTSW 14 55,212,158 (GRCm39) missense probably benign
R0581:Myh7 UTSW 14 55,222,953 (GRCm39) missense probably benign 0.02
R0786:Myh7 UTSW 14 55,230,330 (GRCm39) start codon destroyed probably null
R0866:Myh7 UTSW 14 55,210,596 (GRCm39) missense probably benign
R1068:Myh7 UTSW 14 55,224,776 (GRCm39) missense possibly damaging 0.93
R1075:Myh7 UTSW 14 55,224,860 (GRCm39) missense probably benign
R1124:Myh7 UTSW 14 55,211,327 (GRCm39) missense possibly damaging 0.78
R1140:Myh7 UTSW 14 55,210,339 (GRCm39) missense probably damaging 1.00
R1260:Myh7 UTSW 14 55,225,908 (GRCm39) missense probably benign 0.00
R1653:Myh7 UTSW 14 55,228,246 (GRCm39) missense probably benign 0.00
R1677:Myh7 UTSW 14 55,224,973 (GRCm39) missense probably benign 0.17
R1760:Myh7 UTSW 14 55,210,170 (GRCm39) missense probably damaging 1.00
R1838:Myh7 UTSW 14 55,210,637 (GRCm39) missense possibly damaging 0.91
R1839:Myh7 UTSW 14 55,210,637 (GRCm39) missense possibly damaging 0.91
R2483:Myh7 UTSW 14 55,210,838 (GRCm39) missense probably damaging 0.99
R2566:Myh7 UTSW 14 55,220,699 (GRCm39) missense probably damaging 1.00
R3623:Myh7 UTSW 14 55,210,838 (GRCm39) missense probably damaging 0.99
R4236:Myh7 UTSW 14 55,228,575 (GRCm39) missense probably benign 0.34
R4471:Myh7 UTSW 14 55,229,311 (GRCm39) nonsense probably null
R4700:Myh7 UTSW 14 55,225,778 (GRCm39) missense possibly damaging 0.85
R4805:Myh7 UTSW 14 55,222,590 (GRCm39) missense probably benign 0.27
R4880:Myh7 UTSW 14 55,216,045 (GRCm39) missense probably benign 0.18
R4975:Myh7 UTSW 14 55,209,128 (GRCm39) missense probably damaging 1.00
R4982:Myh7 UTSW 14 55,210,224 (GRCm39) missense probably damaging 0.98
R5004:Myh7 UTSW 14 55,209,140 (GRCm39) missense probably damaging 0.99
R5107:Myh7 UTSW 14 55,223,881 (GRCm39) intron probably benign
R5124:Myh7 UTSW 14 55,223,199 (GRCm39) nonsense probably null
R5256:Myh7 UTSW 14 55,216,965 (GRCm39) missense probably damaging 1.00
R5335:Myh7 UTSW 14 55,224,020 (GRCm39) intron probably benign
R5581:Myh7 UTSW 14 55,216,411 (GRCm39) missense probably benign 0.00
R5861:Myh7 UTSW 14 55,226,347 (GRCm39) missense possibly damaging 0.89
R5957:Myh7 UTSW 14 55,226,535 (GRCm39) missense probably damaging 1.00
R6027:Myh7 UTSW 14 55,208,259 (GRCm39) missense probably benign 0.01
R6184:Myh7 UTSW 14 55,226,315 (GRCm39) missense probably damaging 1.00
R6232:Myh7 UTSW 14 55,226,753 (GRCm39) missense probably benign 0.00
R6268:Myh7 UTSW 14 55,226,741 (GRCm39) missense probably benign 0.00
R6274:Myh7 UTSW 14 55,216,943 (GRCm39) missense probably damaging 0.97
R6345:Myh7 UTSW 14 55,221,149 (GRCm39) missense probably damaging 1.00
R6383:Myh7 UTSW 14 55,226,351 (GRCm39) missense probably benign 0.00
R6641:Myh7 UTSW 14 55,219,737 (GRCm39) missense probably benign 0.37
R6755:Myh7 UTSW 14 55,229,770 (GRCm39) missense possibly damaging 0.71
R6952:Myh7 UTSW 14 55,229,197 (GRCm39) missense probably damaging 1.00
R7025:Myh7 UTSW 14 55,212,101 (GRCm39) nonsense probably null
R7201:Myh7 UTSW 14 55,228,402 (GRCm39) missense possibly damaging 0.58
R7257:Myh7 UTSW 14 55,209,947 (GRCm39) splice site probably null
R7296:Myh7 UTSW 14 55,227,482 (GRCm39) missense probably benign 0.05
R7709:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7710:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7711:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7712:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7817:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7858:Myh7 UTSW 14 55,227,500 (GRCm39) missense probably benign 0.09
R7869:Myh7 UTSW 14 55,226,530 (GRCm39) missense probably damaging 0.99
R7870:Myh7 UTSW 14 55,226,258 (GRCm39) missense probably damaging 1.00
R7887:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
R7931:Myh7 UTSW 14 55,221,119 (GRCm39) missense possibly damaging 0.79
R7936:Myh7 UTSW 14 55,216,920 (GRCm39) missense possibly damaging 0.93
R8056:Myh7 UTSW 14 55,210,776 (GRCm39) nonsense probably null
R8061:Myh7 UTSW 14 55,228,398 (GRCm39) missense probably benign
R8101:Myh7 UTSW 14 55,210,776 (GRCm39) nonsense probably null
R8202:Myh7 UTSW 14 55,227,497 (GRCm39) missense probably benign
R8504:Myh7 UTSW 14 55,227,786 (GRCm39) missense probably damaging 0.98
R8560:Myh7 UTSW 14 55,213,405 (GRCm39) missense possibly damaging 0.93
R8843:Myh7 UTSW 14 55,212,752 (GRCm39) missense probably damaging 0.98
R8903:Myh7 UTSW 14 55,230,228 (GRCm39) nonsense probably null
R8926:Myh7 UTSW 14 55,222,533 (GRCm39) missense probably benign 0.33
R8936:Myh7 UTSW 14 55,228,440 (GRCm39) missense probably benign 0.00
R9182:Myh7 UTSW 14 55,226,374 (GRCm39) missense probably damaging 1.00
R9260:Myh7 UTSW 14 55,224,842 (GRCm39) missense probably damaging 0.99
R9264:Myh7 UTSW 14 55,213,454 (GRCm39) missense probably benign 0.01
R9288:Myh7 UTSW 14 55,222,932 (GRCm39) missense probably benign 0.35
R9362:Myh7 UTSW 14 55,222,932 (GRCm39) missense probably benign 0.00
R9497:Myh7 UTSW 14 55,217,841 (GRCm39) missense probably benign 0.12
R9561:Myh7 UTSW 14 55,216,146 (GRCm39) missense probably damaging 1.00
R9663:Myh7 UTSW 14 55,221,098 (GRCm39) missense probably damaging 1.00
R9789:Myh7 UTSW 14 55,229,384 (GRCm39) missense possibly damaging 0.87
Z1192:Myh7 UTSW 14 55,220,748 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATCTCCATCTCGTTGAGGTC -3'
(R):5'- TTCAAAGCTGACTCCCTCCG -3'

Sequencing Primer
(F):5'- AGGTCGCCCTCCATCTTC -3'
(R):5'- GGGAGTCTGCATCCCCTTC -3'
Posted On 2015-04-17