Incidental Mutation 'R0381:Nab2'
List |< first << previous [record 22 of 34] next >> last >|
ID30978
Institutional Source Beutler Lab
Gene Symbol Nab2
Ensembl Gene ENSMUSG00000025402
Gene NameNgfi-A binding protein 2
Synonyms
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127660918-127668568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127665067 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 19 (A19V)
Ref Sequence ENSEMBL: ENSMUSP00000121737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157] [ENSMUST00000118728] [ENSMUST00000128780] [ENSMUST00000129252]
Predicted Effect probably damaging
Transcript: ENSMUST00000026469
AA Change: A52V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402
AA Change: A52V

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099157
AA Change: A52V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402
AA Change: A52V

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118728
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124388
Predicted Effect probably damaging
Transcript: ENSMUST00000128780
AA Change: A19V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121737
Gene: ENSMUSG00000025402
AA Change: A19V

DomainStartEndE-ValueType
Pfam:NCD1 1 66 3.4e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129252
AA Change: A19V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Nab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Nab2 APN 10 127665109 missense probably damaging 1.00
IGL01415:Nab2 APN 10 127665103 missense probably damaging 1.00
IGL02248:Nab2 APN 10 127663240 missense probably benign 0.31
IGL03080:Nab2 APN 10 127664794 missense possibly damaging 0.56
IGL03084:Nab2 APN 10 127664477 missense probably damaging 1.00
katie UTSW 10 127664338 missense probably damaging 1.00
R1074:Nab2 UTSW 10 127663255 nonsense probably null
R1535:Nab2 UTSW 10 127665047 missense probably damaging 0.99
R4214:Nab2 UTSW 10 127665048 nonsense probably null
R4742:Nab2 UTSW 10 127662827 missense probably benign 0.02
R5590:Nab2 UTSW 10 127664657 missense probably damaging 0.98
R5603:Nab2 UTSW 10 127665121 start codon destroyed probably null 0.96
R5776:Nab2 UTSW 10 127664329 missense probably damaging 0.99
R6018:Nab2 UTSW 10 127664924 nonsense probably null
R6381:Nab2 UTSW 10 127664351 missense probably damaging 1.00
R6610:Nab2 UTSW 10 127664338 missense probably damaging 1.00
R7025:Nab2 UTSW 10 127666508 intron probably benign
R8220:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8221:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8222:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8223:Nab2 UTSW 10 127662776 missense probably benign 0.03
R8277:Nab2 UTSW 10 127665299 intron probably benign
R8293:Nab2 UTSW 10 127666397 missense possibly damaging 0.86
RF005:Nab2 UTSW 10 127664364 missense probably benign 0.04
RF024:Nab2 UTSW 10 127664364 missense probably benign 0.04
Z1176:Nab2 UTSW 10 127663132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCGACAACTTCTCTCCAAGTTC -3'
(R):5'- TCCTGATAGCTTAGGTCGGGCAAC -3'

Sequencing Primer
(F):5'- GCTAAAGCTTCGAGCACTG -3'
(R):5'- CAACCGGCCTTCTGTGC -3'
Posted On2013-04-24