Incidental Mutation 'R3916:Tctn3'
ID309784
Institutional Source Beutler Lab
Gene Symbol Tctn3
Ensembl Gene ENSMUSG00000025008
Gene Nametectonic family member 3
Synonyms4930521E07Rik, Tect3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location40596446-40612233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40607649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 305 (T305S)
Ref Sequence ENSEMBL: ENSMUSP00000121760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025981] [ENSMUST00000132452] [ENSMUST00000134063] [ENSMUST00000135795]
Predicted Effect probably benign
Transcript: ENSMUST00000025981
AA Change: T305S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025981
Gene: ENSMUSG00000025008
AA Change: T305S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 6.3e-83 PFAM
low complexity region 578 590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132452
AA Change: T305S

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121760
Gene: ENSMUSG00000025008
AA Change: T305S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 364 3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134063
SMART Domains Protein: ENSMUSP00000116285
Gene: ENSMUSG00000048120

DomainStartEndE-ValueType
Pfam:GDA1_CD39 69 500 6.9e-170 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135795
AA Change: T305S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123461
Gene: ENSMUSG00000025008
AA Change: T305S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF1619 78 379 2.5e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163023
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Tctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Tctn3 APN 19 40597421 missense probably damaging 0.99
IGL01326:Tctn3 APN 19 40597436 missense probably damaging 1.00
IGL01351:Tctn3 APN 19 40607637 missense probably benign 0.00
IGL01604:Tctn3 APN 19 40605302 splice site probably null
IGL01844:Tctn3 APN 19 40612137 missense probably damaging 0.99
IGL02469:Tctn3 APN 19 40597523 missense probably benign 0.01
FR4449:Tctn3 UTSW 19 40607202 intron probably benign
R0333:Tctn3 UTSW 19 40607267 missense possibly damaging 0.86
R0409:Tctn3 UTSW 19 40611416 splice site probably benign
R1573:Tctn3 UTSW 19 40608917 nonsense probably null
R2288:Tctn3 UTSW 19 40605713 missense probably damaging 1.00
R3792:Tctn3 UTSW 19 40611711 missense probably benign 0.00
R4033:Tctn3 UTSW 19 40597323 missense probably benign 0.23
R4728:Tctn3 UTSW 19 40605742 missense probably damaging 1.00
R5093:Tctn3 UTSW 19 40612104 missense probably damaging 0.99
R5253:Tctn3 UTSW 19 40607241 missense probably benign 0.25
R5334:Tctn3 UTSW 19 40602822 missense probably benign 0.16
R5620:Tctn3 UTSW 19 40608917 nonsense probably null
R6143:Tctn3 UTSW 19 40609227 missense probably benign 0.03
R6166:Tctn3 UTSW 19 40597479 missense possibly damaging 0.92
R7629:Tctn3 UTSW 19 40611336 missense probably damaging 1.00
R8137:Tctn3 UTSW 19 40605341 missense probably damaging 1.00
Z1088:Tctn3 UTSW 19 40607346 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTTAGCACAGAAGACTCTCCAG -3'
(R):5'- AAGTTGTCTGGCAGTGGAAG -3'

Sequencing Primer
(F):5'- AGTCTGTGTTTTAACTGCAAGCC -3'
(R):5'- ATGGTTCAGGAGAAAGCAAACCATTC -3'
Posted On2015-04-17