Incidental Mutation 'R0381:Mrm1'
List |< first << previous [record 19 of 34] next >> last >|
ID30979
Institutional Source Beutler Lab
Gene Symbol Mrm1
Ensembl Gene ENSMUSG00000018405
Gene Namemitochondrial rRNA methyltransferase 1
Synonyms
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84813061-84819515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84818683 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000018549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018549] [ENSMUST00000047560] [ENSMUST00000151496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018549
AA Change: T183A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018549
Gene: ENSMUSG00000018405
AA Change: T183A

DomainStartEndE-ValueType
SpoU_sub_bind 49 127 3.31e-11 SMART
Pfam:SpoU_methylase 143 299 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047560
SMART Domains Protein: ENSMUSP00000043467
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 214 1.4e-46 PFAM
Pfam:KR 13 154 1.7e-11 PFAM
Pfam:Epimerase 14 251 4.8e-7 PFAM
Pfam:adh_short_C2 18 245 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144104
Predicted Effect probably benign
Transcript: ENSMUST00000151496
SMART Domains Protein: ENSMUSP00000122267
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 49 6.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Mrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Mrm1 UTSW 11 84819170 missense possibly damaging 0.73
R0257:Mrm1 UTSW 11 84814823 splice site probably benign
R0563:Mrm1 UTSW 11 84814713 missense probably damaging 1.00
R0715:Mrm1 UTSW 11 84814813 splice site probably benign
R1710:Mrm1 UTSW 11 84818692 missense probably damaging 1.00
R4402:Mrm1 UTSW 11 84819089 missense probably damaging 1.00
R4413:Mrm1 UTSW 11 84819228 missense possibly damaging 0.46
R5266:Mrm1 UTSW 11 84819260 missense possibly damaging 0.58
R5930:Mrm1 UTSW 11 84819192 missense probably damaging 1.00
R7833:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
X0017:Mrm1 UTSW 11 84814923 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGTCGTAGGAATCAATGCCACCAC -3'
(R):5'- TTCCTCGGCGTAGACAGAGTCATC -3'

Sequencing Primer
(F):5'- AATGCCACCACGTCCCTTC -3'
(R):5'- GCGTAGACAGAGTCATCACCAG -3'
Posted On2013-04-24