Incidental Mutation 'R3746:Mpdz'
ID 309797
Institutional Source Beutler Lab
Gene Symbol Mpdz
Ensembl Gene ENSMUSG00000028402
Gene Name multiple PDZ domain protein
Synonyms B930003D11Rik, MUPP1
MMRRC Submission 040732-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3746 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 81278500-81442815 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 81363147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 609 (V609G)
Ref Sequence ENSEMBL: ENSMUSP00000152533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000141995] [ENSMUST00000220807]
AlphaFold Q8VBX6
Predicted Effect probably damaging
Transcript: ENSMUST00000102830
AA Change: V609G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: V609G

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1111 1126 N/A INTRINSIC
PDZ 1148 1231 2.43e-22 SMART
low complexity region 1233 1251 N/A INTRINSIC
PDZ 1346 1421 3.41e-17 SMART
low complexity region 1434 1445 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
PDZ 1479 1552 2.69e-15 SMART
PDZ 1622 1697 3.2e-22 SMART
PDZ 1719 1792 3.62e-21 SMART
low complexity region 1798 1815 N/A INTRINSIC
PDZ 1856 1933 9.79e-18 SMART
PDZ 1980 2055 2.39e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107258
AA Change: V609G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: V609G

DomainStartEndE-ValueType
PDZ 1 73 3.42e-8 SMART
low complexity region 104 119 N/A INTRINSIC
PDZ 141 224 2.43e-22 SMART
PDZ 306 381 3.41e-17 SMART
low complexity region 394 405 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
PDZ 439 512 2.69e-15 SMART
PDZ 582 657 3.2e-22 SMART
PDZ 679 752 3.62e-21 SMART
low complexity region 758 775 N/A INTRINSIC
PDZ 816 893 9.79e-18 SMART
PDZ 940 1015 2.39e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107262
AA Change: V609G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: V609G

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1112 1127 N/A INTRINSIC
PDZ 1149 1232 2.43e-22 SMART
low complexity region 1234 1252 N/A INTRINSIC
PDZ 1347 1422 3.41e-17 SMART
low complexity region 1435 1446 N/A INTRINSIC
low complexity region 1455 1469 N/A INTRINSIC
PDZ 1480 1553 2.69e-15 SMART
PDZ 1623 1698 3.2e-22 SMART
PDZ 1720 1793 3.62e-21 SMART
low complexity region 1799 1816 N/A INTRINSIC
PDZ 1857 1934 9.79e-18 SMART
PDZ 1981 2056 2.39e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141995
SMART Domains Protein: ENSMUSP00000118283
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
PDZ 82 161 9.94e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220807
AA Change: V609G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5514 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Irf3 T C 7: 44,998,873 F54S probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Plekhn1 T C 4: 156,225,594 T88A probably benign Het
Rmdn2 T A 17: 79,670,552 probably null Het
Selenom A G 11: 3,517,132 E137G probably benign Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vmn2r76 A G 7: 86,225,555 V738A probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Mpdz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mpdz APN 4 81310224 nonsense probably null
IGL00325:Mpdz APN 4 81317631 missense probably damaging 1.00
IGL00497:Mpdz APN 4 81335742 missense probably benign 0.30
IGL00502:Mpdz APN 4 81369723 missense probably damaging 1.00
IGL00539:Mpdz APN 4 81361351 missense possibly damaging 0.83
IGL00938:Mpdz APN 4 81292512 missense probably damaging 1.00
IGL00990:Mpdz APN 4 81303584 splice site probably benign
IGL01394:Mpdz APN 4 81292491 missense possibly damaging 0.92
IGL01537:Mpdz APN 4 81369658 missense probably damaging 0.98
IGL01558:Mpdz APN 4 81295530 nonsense probably null
IGL01561:Mpdz APN 4 81284614 missense probably damaging 1.00
IGL01649:Mpdz APN 4 81303633 missense probably damaging 0.98
IGL01743:Mpdz APN 4 81317682 missense probably damaging 1.00
IGL01941:Mpdz APN 4 81286387 missense possibly damaging 0.91
IGL01969:Mpdz APN 4 81358724 missense probably damaging 0.98
IGL02023:Mpdz APN 4 81329529 missense probably damaging 0.99
IGL02081:Mpdz APN 4 81335869 missense probably damaging 1.00
IGL02304:Mpdz APN 4 81310157 missense possibly damaging 0.78
IGL02304:Mpdz APN 4 81297559 splice site probably benign
IGL02410:Mpdz APN 4 81297493 missense probably benign 0.13
IGL02449:Mpdz APN 4 81329422 splice site probably null
IGL02671:Mpdz APN 4 81290273 missense probably damaging 1.00
IGL02708:Mpdz APN 4 81284571 splice site probably null
IGL02718:Mpdz APN 4 81385202 missense probably damaging 1.00
IGL03065:Mpdz APN 4 81292565 missense probably damaging 0.98
IGL03378:Mpdz APN 4 81419048 splice site probably benign
PIT4458001:Mpdz UTSW 4 81419026 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0119:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0402:Mpdz UTSW 4 81361440 missense possibly damaging 0.51
R0499:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0718:Mpdz UTSW 4 81292473 missense possibly damaging 0.79
R0844:Mpdz UTSW 4 81421194 start gained probably benign
R0883:Mpdz UTSW 4 81359991 splice site probably benign
R0885:Mpdz UTSW 4 81369592 missense probably benign 0.04
R1344:Mpdz UTSW 4 81308319 missense probably benign 0.01
R1432:Mpdz UTSW 4 81292551 missense probably damaging 1.00
R1488:Mpdz UTSW 4 81348708 nonsense probably null
R1589:Mpdz UTSW 4 81421176 missense probably benign 0.00
R1756:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R1940:Mpdz UTSW 4 81361443 missense probably benign 0.01
R2068:Mpdz UTSW 4 81335830 missense probably null 1.00
R2182:Mpdz UTSW 4 81348722 missense probably damaging 1.00
R2213:Mpdz UTSW 4 81310172 missense probably damaging 0.99
R2265:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2268:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2269:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R3082:Mpdz UTSW 4 81285458 splice site probably benign
R3902:Mpdz UTSW 4 81307116 missense probably damaging 1.00
R4095:Mpdz UTSW 4 81383823 missense possibly damaging 0.77
R4097:Mpdz UTSW 4 81335700 missense probably damaging 1.00
R4206:Mpdz UTSW 4 81381762 missense probably benign 0.13
R4675:Mpdz UTSW 4 81383812 missense probably damaging 0.98
R4884:Mpdz UTSW 4 81361476 missense probably damaging 0.97
R5044:Mpdz UTSW 4 81381697 missense probably benign 0.16
R5050:Mpdz UTSW 4 81295448 missense probably benign 0.00
R5243:Mpdz UTSW 4 81306879 missense probably damaging 1.00
R5332:Mpdz UTSW 4 81292580 missense probably damaging 1.00
R5435:Mpdz UTSW 4 81283487 intron probably benign
R5720:Mpdz UTSW 4 81287694 missense probably damaging 0.99
R5743:Mpdz UTSW 4 81421188 start codon destroyed probably null 0.30
R5764:Mpdz UTSW 4 81356446 missense probably benign 0.13
R5876:Mpdz UTSW 4 81285474 nonsense probably null
R5938:Mpdz UTSW 4 81284614 missense probably damaging 1.00
R5988:Mpdz UTSW 4 81284575 critical splice donor site probably null
R6125:Mpdz UTSW 4 81297527 missense probably benign 0.00
R6178:Mpdz UTSW 4 81308365 missense probably damaging 1.00
R6235:Mpdz UTSW 4 81385281 missense probably damaging 1.00
R6293:Mpdz UTSW 4 81360056 missense probably damaging 1.00
R6387:Mpdz UTSW 4 81381709 missense possibly damaging 0.69
R6488:Mpdz UTSW 4 81287733 missense probably benign 0.11
R6536:Mpdz UTSW 4 81383417 missense probably damaging 1.00
R6673:Mpdz UTSW 4 81356430 missense probably benign 0.11
R6879:Mpdz UTSW 4 81348656 missense possibly damaging 0.81
R7180:Mpdz UTSW 4 81335751 missense probably damaging 0.98
R7199:Mpdz UTSW 4 81297333 missense probably damaging 0.98
R7209:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R7309:Mpdz UTSW 4 81381958 splice site probably null
R7359:Mpdz UTSW 4 81356395 missense probably benign 0.01
R7561:Mpdz UTSW 4 81307151 missense probably damaging 0.99
R7565:Mpdz UTSW 4 81303654 missense probably benign 0.01
R7738:Mpdz UTSW 4 81335749 missense probably benign 0.01
R7941:Mpdz UTSW 4 81282750 missense probably benign 0.04
R8074:Mpdz UTSW 4 81349087 missense probably benign 0.00
R8957:Mpdz UTSW 4 81332979 nonsense probably null
R8998:Mpdz UTSW 4 81284645 nonsense probably null
R8999:Mpdz UTSW 4 81284645 nonsense probably null
R9001:Mpdz UTSW 4 81381762 missense probably benign
R9223:Mpdz UTSW 4 81284630 missense probably damaging 1.00
R9415:Mpdz UTSW 4 81317668 nonsense probably null
RF013:Mpdz UTSW 4 81293592 missense possibly damaging 0.60
X0011:Mpdz UTSW 4 81292759 critical splice donor site probably null
Z1177:Mpdz UTSW 4 81320490 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTGTTAAGCATCAAATTAGCCTTCC -3'
(R):5'- GAGCTCAAGTTCAGGTCCTG -3'

Sequencing Primer
(F):5'- ATCAAATTAGCCTTCCTTCTGTGAG -3'
(R):5'- TTGCACAGGTCTAACTGCAG -3'
Posted On 2015-04-17