Mutagenetix > Incidental Mutation

Incidental Mutation 'R3746:Ago1'

309799

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

040732-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.751) question?

Stock #

R3746 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126461044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 125 (I125T)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably benign
Transcript: ENSMUST00000097888
AA Change: I125T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I125T

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000127800
AA Change: I47T

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149425

Predicted Effect

probably benign
Transcript: ENSMUST00000176315

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Meta Mutation Damage Score

0.0639

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abcb5	T	C	12: 118,874,620	D1069G	probably damaging	Het
Ccdc40	T	C	11: 119,264,426	V1164A	probably benign	Het
Chd7	G	A	4: 8,752,537	V345M	probably damaging	Het
Cln6	A	G	9: 62,847,002	I109V	probably benign	Het
Csmd3	A	T	15: 47,849,766	F1604Y	probably benign	Het
Cx3cr1	T	C	9: 120,052,066	H90R	probably damaging	Het
Dip2c	A	T	13: 9,601,473	D674V	probably damaging	Het
Dnah17	T	C	11: 118,082,916	S1935G	probably benign	Het
Eif3g	G	A	9: 20,894,697	R295C	probably benign	Het
Epha5	T	C	5: 84,059,104	K998E	probably damaging	Het
Fam171b	A	T	2: 83,879,600	T539S	probably damaging	Het
Fer1l4	G	T	2: 156,035,048	H1159N	probably benign	Het
Fsip1	A	G	2: 118,233,050	C313R	probably damaging	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Gm37240	T	G	3: 84,519,612	N168T	probably benign	Het
Gm7589	T	C	9: 59,145,855		noncoding transcript	Het
Igkv20-101-2	A	T	6: 68,474,958	I66L	possibly damaging	Het
Irf3	T	C	7: 44,998,873	F54S	probably damaging	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Lrp10	A	T	14: 54,469,266	N520I	possibly damaging	Het
Map3k21	A	G	8: 125,935,100	K479E	probably damaging	Het
Mpdz	A	C	4: 81,363,147	V609G	probably damaging	Het
Olfr65	T	A	7: 103,907,060	M207K	probably benign	Het
Opcml	G	A	9: 28,901,530	V173M	possibly damaging	Het
Osbpl7	T	C	11: 97,056,053	V223A	probably damaging	Het
Pcdh17	A	T	14: 84,533,037	Y985F	probably benign	Het
Piezo1	G	T	8: 122,492,638	F1084L	probably damaging	Het
Pkhd1	A	G	1: 20,058,300	*4060Q	probably null	Het
Plekhn1	T	C	4: 156,225,594	T88A	probably benign	Het
Rmdn2	T	A	17: 79,670,552		probably null	Het
Selenom	A	G	11: 3,517,132	E137G	probably benign	Het
Slc38a7	A	G	8: 95,843,752		probably benign	Het
Slc39a12	T	C	2: 14,396,067		probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Supt16	A	G	14: 52,180,139	L306P	probably damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trim63	G	A	4: 134,315,354	C44Y	probably damaging	Het
Ush2a	G	A	1: 188,810,292	G3352S	probably benign	Het
Vmn1r4	A	G	6: 56,957,131	R207G	probably damaging	Het
Vmn2r76	A	G	7: 86,225,555	V738A	probably benign	Het
Vwa5b2	A	G	16: 20,598,326		probably benign	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTTACCAACACTGTCGCTTAG -3'
(R):5'- AGAAGCACTGGGGCATCATC -3'

Sequencing Primer
(F):5'- CCAACACTGTCGCTTAGATAATAAC -3'
(R):5'- AAGTACACTGTAGCTGTCTTCAGGC -3'

Posted On

2015-04-17