Incidental Mutation 'R0381:Ntsr2'
List |< first << previous [record 23 of 34] next >> last >|
ID30980
Institutional Source Beutler Lab
Gene Symbol Ntsr2
Ensembl Gene ENSMUSG00000020591
Gene Nameneurotensin receptor 2
SynonymsNTRL, NT2R
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16653382-16660227 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 16659718 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 333 (Y333*)
Ref Sequence ENSEMBL: ENSMUSP00000106693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]
Predicted Effect probably null
Transcript: ENSMUST00000111064
AA Change: Y333*
SMART Domains Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: Y333*

DomainStartEndE-ValueType
Pfam:7tm_1 49 358 4.2e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000220892
AA Change: M273K
Predicted Effect probably benign
Transcript: ENSMUST00000221049
AA Change: M228K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000221596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222957
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Ntsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Ntsr2 APN 12 16659848 missense probably damaging 0.97
IGL01973:Ntsr2 APN 12 16656774 missense probably benign 0.01
IGL02202:Ntsr2 APN 12 16653660 missense probably damaging 0.99
IGL02493:Ntsr2 APN 12 16658389 missense possibly damaging 0.90
IGL02837:Ntsr2 UTSW 12 16653875 missense probably damaging 0.99
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0437:Ntsr2 UTSW 12 16653695 missense probably damaging 1.00
R0666:Ntsr2 UTSW 12 16653980 missense probably benign 0.28
R0751:Ntsr2 UTSW 12 16654030 missense probably damaging 1.00
R1919:Ntsr2 UTSW 12 16654110 missense probably damaging 0.96
R2190:Ntsr2 UTSW 12 16654017 missense probably damaging 1.00
R5323:Ntsr2 UTSW 12 16659933 missense probably benign 0.00
R5358:Ntsr2 UTSW 12 16654082 missense probably damaging 1.00
R6282:Ntsr2 UTSW 12 16658425 missense probably damaging 1.00
R6358:Ntsr2 UTSW 12 16656768 missense probably benign 0.29
R6523:Ntsr2 UTSW 12 16656696 missense probably benign 0.05
R6837:Ntsr2 UTSW 12 16659709 missense probably benign 0.04
R8396:Ntsr2 UTSW 12 16656820 missense probably damaging 1.00
R8418:Ntsr2 UTSW 12 16656661 missense possibly damaging 0.83
RF017:Ntsr2 UTSW 12 16659765 missense probably damaging 0.99
X0064:Ntsr2 UTSW 12 16656757 missense probably damaging 1.00
Z1177:Ntsr2 UTSW 12 16653662 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACTGCAAAGAATCTGCCACATGGAG -3'
(R):5'- GTCCCAAGCAGCCATTGTTTGTTC -3'

Sequencing Primer
(F):5'- TCAGTAATCATAGCCAGGAAGTC -3'
(R):5'- ACACTTGTATTTCACCCAGGC -3'
Posted On2013-04-24