Incidental Mutation 'R3746:Plekhn1'
ID309801
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Namepleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 040732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3746 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156221456-156234857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156225594 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 88 (T88A)
Ref Sequence ENSEMBL: ENSMUSP00000151311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105569
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105571
AA Change: T88A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: T88A

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184043
Predicted Effect probably benign
Transcript: ENSMUST00000217885
AA Change: T88A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000218699
AA Change: T88A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Irf3 T C 7: 44,998,873 F54S probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Mpdz A C 4: 81,363,147 V609G probably damaging Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Rmdn2 T A 17: 79,670,552 probably null Het
Selenom A G 11: 3,517,132 E137G probably benign Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vmn2r76 A G 7: 86,225,555 V738A probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156222408 missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156223856 critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156223649 missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156224940 nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156224811 missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156228246 missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156228323 splice site probably benign
R0540:Plekhn1 UTSW 4 156222747 missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156225201 missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156225364 missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156228263 missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156223564 critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156222381 missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156221882 missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156222701 missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156222659 missense probably damaging 1.00
R3818:Plekhn1 UTSW 4 156225533 missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156225669 missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156224750 missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156224693 unclassified probably null
R4176:Plekhn1 UTSW 4 156221801 missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156225356 missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156225273 splice site probably null
R4477:Plekhn1 UTSW 4 156223399 missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156222424 missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156224765 missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156230527 missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156223874 missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156222695 missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156225239 missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156230558 synonymous probably null
R6263:Plekhn1 UTSW 4 156225193 critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156221804 missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156224793 missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156224569 missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156221792 missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156233917 missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156223335 missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156222671 missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156233961 missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156230685 missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156233314 missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156224820 missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156225653 missense probably benign 0.00
X0023:Plekhn1 UTSW 4 156222354 missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156224915 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCATGGGCCTGGAAGTAC -3'
(R):5'- CTTGAGGAATGCATTCTGTGGC -3'

Sequencing Primer
(F):5'- ATAGCAGTCACTGATGTCCTAGG -3'
(R):5'- AATGCATTCTGTGGCCACGC -3'
Posted On2015-04-17