Incidental Mutation 'R3746:Aasdh'
ID 309802
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 040732-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R3746 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 77036501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 347 (E347*)
Ref Sequence ENSEMBL: ENSMUSP00000117639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
AlphaFold Q80WC9
Predicted Effect probably null
Transcript: ENSMUST00000069709
AA Change: E347*
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120963
AA Change: E347*
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123059
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126741
AA Change: E347*
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect probably null
Transcript: ENSMUST00000146570
AA Change: E347*
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201283
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,838,355 (GRCm39) D1069G probably damaging Het
Ago1 A G 4: 126,354,837 (GRCm39) I125T probably benign Het
Ccdc40 T C 11: 119,155,252 (GRCm39) V1164A probably benign Het
Chd7 G A 4: 8,752,537 (GRCm39) V345M probably damaging Het
Cln6 A G 9: 62,754,284 (GRCm39) I109V probably benign Het
Csmd3 A T 15: 47,713,162 (GRCm39) F1604Y probably benign Het
Cx3cr1 T C 9: 119,881,132 (GRCm39) H90R probably damaging Het
Dip2c A T 13: 9,651,509 (GRCm39) D674V probably damaging Het
Dnah17 T C 11: 117,973,742 (GRCm39) S1935G probably benign Het
Eif3g G A 9: 20,805,993 (GRCm39) R295C probably benign Het
Epha5 T C 5: 84,206,963 (GRCm39) K998E probably damaging Het
Fam171b A T 2: 83,709,944 (GRCm39) T539S probably damaging Het
Fer1l4 G T 2: 155,876,968 (GRCm39) H1159N probably benign Het
Fsip1 A G 2: 118,063,531 (GRCm39) C313R probably damaging Het
Gm37240 T G 3: 84,426,919 (GRCm39) N168T probably benign Het
Gm7589 T C 9: 59,053,138 (GRCm39) noncoding transcript Het
Igkv20-101-2 A T 6: 68,451,942 (GRCm39) I66L possibly damaging Het
Irf3 T C 7: 44,648,297 (GRCm39) F54S probably damaging Het
Lrba T G 3: 86,283,260 (GRCm39) L1858R probably damaging Het
Lrp10 A T 14: 54,706,723 (GRCm39) N520I possibly damaging Het
Map3k21 A G 8: 126,661,839 (GRCm39) K479E probably damaging Het
Mpdz A C 4: 81,281,384 (GRCm39) V609G probably damaging Het
Opcml G A 9: 28,812,826 (GRCm39) V173M possibly damaging Het
Or51b6 T A 7: 103,556,267 (GRCm39) M207K probably benign Het
Osbpl7 T C 11: 96,946,879 (GRCm39) V223A probably damaging Het
Pcdh17 A T 14: 84,770,477 (GRCm39) Y985F probably benign Het
Piezo1 G T 8: 123,219,377 (GRCm39) F1084L probably damaging Het
Pkhd1 A G 1: 20,128,524 (GRCm39) *4060Q probably null Het
Plekhn1 T C 4: 156,310,051 (GRCm39) T88A probably benign Het
Pramel18 T A 4: 101,767,073 (GRCm39) D107E possibly damaging Het
Rmdn2 T A 17: 79,977,981 (GRCm39) probably null Het
Selenom A G 11: 3,467,132 (GRCm39) E137G probably benign Het
Slc38a7 A G 8: 96,570,380 (GRCm39) probably benign Het
Slc39a12 T C 2: 14,400,878 (GRCm39) probably benign Het
Slk T G 19: 47,608,248 (GRCm39) D400E possibly damaging Het
Supt16 A G 14: 52,417,596 (GRCm39) L306P probably damaging Het
Tas2r136 A T 6: 132,754,200 (GRCm39) F309Y probably damaging Het
Tmem63a G A 1: 180,790,679 (GRCm39) D446N possibly damaging Het
Trim63 G A 4: 134,042,665 (GRCm39) C44Y probably damaging Het
Ush2a G A 1: 188,542,489 (GRCm39) G3352S probably benign Het
Vmn1r4 A G 6: 56,934,116 (GRCm39) R207G probably damaging Het
Vmn2r76 A G 7: 85,874,763 (GRCm39) V738A probably benign Het
Vwa5b2 A G 16: 20,417,076 (GRCm39) probably benign Het
Zfhx4 G A 3: 5,308,225 (GRCm39) E484K possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGAGTGTGCTTCCTACGC -3'
(R):5'- GCAACGCCAACATTGCTGAG -3'

Sequencing Primer
(F):5'- TACGCAAGGACATGACTTGTAC -3'
(R):5'- CGCCAACATTGCTGAGAAGATTTG -3'
Posted On 2015-04-17