Incidental Mutation 'R3746:Aasdh'
ID309802
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission 040732-MU
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3746 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 76888654 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 347 (E347*)
Ref Sequence ENSEMBL: ENSMUSP00000117639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
AlphaFold Q80WC9
Predicted Effect probably null
Transcript: ENSMUST00000069709
AA Change: E347*
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120963
AA Change: E347*
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123059
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126741
AA Change: E347*
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect probably null
Transcript: ENSMUST00000146570
AA Change: E347*
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: E347*

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201283
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Irf3 T C 7: 44,998,873 F54S probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Mpdz A C 4: 81,363,147 V609G probably damaging Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Plekhn1 T C 4: 156,225,594 T88A probably benign Het
Rmdn2 T A 17: 79,670,552 probably null Het
Selenom A G 11: 3,517,132 E137G probably benign Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vmn2r76 A G 7: 86,225,555 V738A probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8425:Aasdh UTSW 5 76886277 missense possibly damaging 0.49
R8884:Aasdh UTSW 5 76891794 missense possibly damaging 0.94
R9028:Aasdh UTSW 5 76876130 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGAGTGTGCTTCCTACGC -3'
(R):5'- GCAACGCCAACATTGCTGAG -3'

Sequencing Primer
(F):5'- TACGCAAGGACATGACTTGTAC -3'
(R):5'- CGCCAACATTGCTGAGAAGATTTG -3'
Posted On2015-04-17