Mutagenetix > Incidental Mutations

Incidental Mutation 'R3746:Epha5'

309803

Institutional Source

Beutler Lab

Gene Symbol

Epha5

Ensembl Gene

ENSMUSG00000029245

Gene Name

Eph receptor A5

Synonyms

Rek7, Ehk1, Hek7, Cek7, bsk, Els1

MMRRC Submission

040732-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3746 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84054761-84417382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84059104 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 998 (K998E)

Ref Sequence

ENSEMBL: ENSMUSP00000109033 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113403] [ENSMUST00000113406]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053733
AA Change: K857E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: K857E

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	413	511	2.1e-22	PFAM
TyrKc	514	771	9.33e-138	SMART
SAM	801	868	6.65e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113403
AA Change: K1021E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: K1021E

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	1.2e-25	PFAM
TyrKc	678	935	9.33e-138	SMART
SAM	965	1032	6.65e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113406
AA Change: K998E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: K998E

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	575	652	1.9e-30	PFAM
TyrKc	655	912	9.33e-138	SMART
SAM	942	1009	6.65e-23	SMART

Meta Mutation Damage Score

0.4619

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abcb5	T	C	12: 118,874,620	D1069G	probably damaging	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Ccdc40	T	C	11: 119,264,426	V1164A	probably benign	Het
Chd7	G	A	4: 8,752,537	V345M	probably damaging	Het
Cln6	A	G	9: 62,847,002	I109V	probably benign	Het
Csmd3	A	T	15: 47,849,766	F1604Y	probably benign	Het
Cx3cr1	T	C	9: 120,052,066	H90R	probably damaging	Het
Dip2c	A	T	13: 9,601,473	D674V	probably damaging	Het
Dnah17	T	C	11: 118,082,916	S1935G	probably benign	Het
Eif3g	G	A	9: 20,894,697	R295C	probably benign	Het
Fam171b	A	T	2: 83,879,600	T539S	probably damaging	Het
Fer1l4	G	T	2: 156,035,048	H1159N	probably benign	Het
Fsip1	A	G	2: 118,233,050	C313R	probably damaging	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Gm37240	T	G	3: 84,519,612	N168T	probably benign	Het
Gm7589	T	C	9: 59,145,855		noncoding transcript	Het
Igkv20-101-2	A	T	6: 68,474,958	I66L	possibly damaging	Het
Irf3	T	C	7: 44,998,873	F54S	probably damaging	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Lrp10	A	T	14: 54,469,266	N520I	possibly damaging	Het
Map3k21	A	G	8: 125,935,100	K479E	probably damaging	Het
Mpdz	A	C	4: 81,363,147	V609G	probably damaging	Het
Olfr65	T	A	7: 103,907,060	M207K	probably benign	Het
Opcml	G	A	9: 28,901,530	V173M	possibly damaging	Het
Osbpl7	T	C	11: 97,056,053	V223A	probably damaging	Het
Pcdh17	A	T	14: 84,533,037	Y985F	probably benign	Het
Piezo1	G	T	8: 122,492,638	F1084L	probably damaging	Het
Pkhd1	A	G	1: 20,058,300	*4060Q	probably null	Het
Plekhn1	T	C	4: 156,225,594	T88A	probably benign	Het
Rmdn2	T	A	17: 79,670,552		probably null	Het
Selenom	A	G	11: 3,517,132	E137G	probably benign	Het
Slc38a7	A	G	8: 95,843,752		probably benign	Het
Slc39a12	T	C	2: 14,396,067		probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Supt16	A	G	14: 52,180,139	L306P	probably damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trim63	G	A	4: 134,315,354	C44Y	probably damaging	Het
Ush2a	G	A	1: 188,810,292	G3352S	probably benign	Het
Vmn1r4	A	G	6: 56,957,131	R207G	probably damaging	Het
Vmn2r76	A	G	7: 86,225,555	V738A	probably benign	Het
Vwa5b2	A	G	16: 20,598,326		probably benign	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het

Other mutations in Epha5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00808:Epha5	APN	5	84106700	missense	probably damaging	1.00
IGL01084:Epha5	APN	5	84071087	nonsense	probably null
IGL01462:Epha5	APN	5	84071233	missense	probably damaging	1.00
IGL01516:Epha5	APN	5	84386276	missense	probably damaging	1.00
IGL01998:Epha5	APN	5	84084734	missense	probably damaging	1.00
IGL02744:Epha5	APN	5	84107989	missense	probably benign	0.22
IGL03076:Epha5	APN	5	84331690	missense	probably damaging	1.00
IGL03123:Epha5	APN	5	84331226	critical splice donor site	probably null
IGL03381:Epha5	APN	5	84331332	missense	probably damaging	0.98
PIT4544001:Epha5	UTSW	5	84331612	missense	possibly damaging	0.71
R0004:Epha5	UTSW	5	84331842	missense	probably damaging	1.00
R0490:Epha5	UTSW	5	84107974	splice site	probably benign
R0545:Epha5	UTSW	5	84067358	critical splice donor site	probably null
R0835:Epha5	UTSW	5	84386242	missense	probably damaging	1.00
R1074:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1074:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1102:Epha5	UTSW	5	84233575	splice site	probably benign
R1184:Epha5	UTSW	5	84071275	intron	probably null
R1255:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1255:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1327:Epha5	UTSW	5	84106785	missense	probably damaging	1.00
R1437:Epha5	UTSW	5	84233696	missense	probably damaging	1.00
R1804:Epha5	UTSW	5	84331815	missense	probably benign	0.21
R1967:Epha5	UTSW	5	84416429	missense	probably benign	0.23
R2187:Epha5	UTSW	5	84086364	missense	probably damaging	1.00
R2282:Epha5	UTSW	5	84150410	missense	probably damaging	1.00
R2899:Epha5	UTSW	5	84233808	missense	probably damaging	0.99
R4454:Epha5	UTSW	5	84156444	missense	probably damaging	1.00
R4771:Epha5	UTSW	5	84150419	missense	probably damaging	0.99
R4809:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4810:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4825:Epha5	UTSW	5	84233840	missense	probably damaging	0.97
R4833:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4961:Epha5	UTSW	5	84233643	missense	probably damaging	1.00
R4976:Epha5	UTSW	5	84084824	missense	probably damaging	1.00
R4981:Epha5	UTSW	5	84150483	missense	probably damaging	1.00
R5149:Epha5	UTSW	5	84150358	missense	probably damaging	1.00
R5422:Epha5	UTSW	5	84331490	missense	probably damaging	1.00
R5575:Epha5	UTSW	5	84416502	missense	probably damaging	0.97
R5664:Epha5	UTSW	5	84331866	missense	probably damaging	1.00
R5801:Epha5	UTSW	5	84331226	critical splice donor site	probably null
R5821:Epha5	UTSW	5	84084728	missense	probably damaging	1.00
R5924:Epha5	UTSW	5	84233674	nonsense	probably null
R5951:Epha5	UTSW	5	84331192	intron	probably benign
R5956:Epha5	UTSW	5	84150369	missense	probably damaging	0.99
R6127:Epha5	UTSW	5	84071094	missense	probably damaging	1.00
R6189:Epha5	UTSW	5	84237540	missense	probably damaging	1.00
R6240:Epha5	UTSW	5	84117579	missense	probably benign	0.27
R6343:Epha5	UTSW	5	84106747	missense	probably damaging	1.00
R6463:Epha5	UTSW	5	84106710	missense	probably damaging	1.00
R6517:Epha5	UTSW	5	84156501	missense	possibly damaging	0.63
R6622:Epha5	UTSW	5	84237528	missense	possibly damaging	0.79
R6667:Epha5	UTSW	5	84071191	missense	probably damaging	1.00
R6741:Epha5	UTSW	5	84106698	missense	possibly damaging	0.69
R6757:Epha5	UTSW	5	84105878	missense	probably damaging	1.00
R6762:Epha5	UTSW	5	84331726	missense	probably damaging	1.00
R6819:Epha5	UTSW	5	84106790	missense	probably damaging	1.00
R7019:Epha5	UTSW	5	84416462	missense	possibly damaging	0.68
R7031:Epha5	UTSW	5	84142300	missense	probably benign	0.12
R7213:Epha5	UTSW	5	84233923	splice site	probably null
R7728:Epha5	UTSW	5	84067408	missense	possibly damaging	0.95
Z1088:Epha5	UTSW	5	84237522	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCTGTACATTGTGGATTAAGAGGAAG -3'
(R):5'- ACCCACCTTTGAGAACTGGAC -3'

Sequencing Primer
(F):5'- ACTCAAAGGTTAAGGCAAATGC -3'
(R):5'- CACCTTTGAGAACTGGACTGTGAC -3'

Posted On

2015-04-17