Incidental Mutation 'R3746:Olfr65'
ID309808
Institutional Source Beutler Lab
Gene Symbol Olfr65
Ensembl Gene ENSMUSG00000110259
Gene Nameolfactory receptor 65
Synonyms5'[b]3, GA_x6K02T2PBJ9-6634906-6633983, MOR1-2
MMRRC Submission 040732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3746 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103903487-103908650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103907060 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 207 (M207K)
Ref Sequence ENSEMBL: ENSMUSP00000147914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106864] [ENSMUST00000209528] [ENSMUST00000214300]
Predicted Effect probably benign
Transcript: ENSMUST00000106864
AA Change: M204K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102477
Gene: ENSMUSG00000110259
AA Change: M204K

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 2.1e-113 PFAM
Pfam:7TM_GPCR_Srsx 36 300 5.6e-7 PFAM
Pfam:7tm_1 42 293 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209528
AA Change: M207K

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000214300
AA Change: M204K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Irf3 T C 7: 44,998,873 F54S probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Mpdz A C 4: 81,363,147 V609G probably damaging Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Plekhn1 T C 4: 156,225,594 T88A probably benign Het
Rmdn2 T A 17: 79,670,552 probably null Het
Selenom A G 11: 3,517,132 E137G probably benign Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vmn2r76 A G 7: 86,225,555 V738A probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Olfr65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr65 APN 7 103906462 missense probably benign
IGL02830:Olfr65 APN 7 103906444 missense probably benign 0.32
IGL03238:Olfr65 APN 7 103906510 missense probably benign
R0674:Olfr65 UTSW 7 103907255 missense probably benign 0.01
R1711:Olfr65 UTSW 7 103906699 missense probably damaging 1.00
R2018:Olfr65 UTSW 7 103907042 missense possibly damaging 0.88
R2363:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R2968:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R2970:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R4928:Olfr65 UTSW 7 103906672 missense probably damaging 1.00
R5092:Olfr65 UTSW 7 103907199 nonsense probably null
R5635:Olfr65 UTSW 7 103906638 missense probably benign 0.05
R5881:Olfr65 UTSW 7 103906676 missense probably damaging 0.98
R5963:Olfr65 UTSW 7 103906961 missense probably benign 0.02
R5969:Olfr65 UTSW 7 103906910 missense probably damaging 0.98
R6859:Olfr65 UTSW 7 103906701 nonsense probably null
X0065:Olfr65 UTSW 7 103907216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGGCATAGGCGTAGTG -3'
(R):5'- CATTGTGATGTGGACGACATGAG -3'

Sequencing Primer
(F):5'- GATGAGGGCTGGTCTGTCAATC -3'
(R):5'- GGACGACATGAGGAACATTCTTTCC -3'
Posted On2015-04-17