Incidental Mutation 'R0381:Vmn1r201'
List |< first << previous [record 32 of 34] next >> last >|
ID30981
Institutional Source Beutler Lab
Gene Symbol Vmn1r201
Ensembl Gene ENSMUSG00000094898
Gene Namevomeronasal 1 receptor 201
SynonymsV1ri4
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22471923-22478701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22475023 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 136 (W136R)
Ref Sequence ENSEMBL: ENSMUSP00000154790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091730] [ENSMUST00000226330] [ENSMUST00000226965]
Predicted Effect probably damaging
Transcript: ENSMUST00000091730
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089324
Gene: ENSMUSG00000094898
AA Change: W136R

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 2.4e-9 PFAM
Pfam:V1R 35 299 1.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226330
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226965
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Vmn1r201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Vmn1r201 APN 13 22474844 missense probably damaging 0.97
IGL03137:Vmn1r201 APN 13 22474804 missense probably benign 0.01
R0278:Vmn1r201 UTSW 13 22475024 missense probably damaging 1.00
R0544:Vmn1r201 UTSW 13 22475146 missense probably benign 0.04
R1411:Vmn1r201 UTSW 13 22474679 missense probably benign 0.01
R1544:Vmn1r201 UTSW 13 22474798 missense probably benign 0.20
R1850:Vmn1r201 UTSW 13 22474631 missense probably benign 0.08
R1891:Vmn1r201 UTSW 13 22475255 missense probably benign 0.01
R2071:Vmn1r201 UTSW 13 22474825 missense probably benign 0.34
R4183:Vmn1r201 UTSW 13 22474852 missense probably benign 0.01
R4924:Vmn1r201 UTSW 13 22474712 missense probably benign 0.00
R4989:Vmn1r201 UTSW 13 22475452 missense possibly damaging 0.95
R5028:Vmn1r201 UTSW 13 22475360 nonsense probably null
R5318:Vmn1r201 UTSW 13 22474922 missense probably damaging 1.00
R5369:Vmn1r201 UTSW 13 22475502 missense probably benign 0.00
R5682:Vmn1r201 UTSW 13 22475185 missense probably damaging 0.99
R5699:Vmn1r201 UTSW 13 22475239 missense probably damaging 1.00
R6180:Vmn1r201 UTSW 13 22475329 missense possibly damaging 0.94
R6273:Vmn1r201 UTSW 13 22475215 missense probably damaging 1.00
R6295:Vmn1r201 UTSW 13 22475363 missense probably benign 0.00
R6331:Vmn1r201 UTSW 13 22475351 missense probably damaging 1.00
R7296:Vmn1r201 UTSW 13 22475339 missense possibly damaging 0.69
R7758:Vmn1r201 UTSW 13 22474819 missense not run
R7832:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7887:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
R7976:Vmn1r201 UTSW 13 22474705 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCAGTTTATCTGGCAAGGATGGC -3'
(R):5'- CACCGTGAAACCTGTGTAGAAGGAG -3'

Sequencing Primer
(F):5'- AGTCCCAGGACAACCATTTGG -3'
(R):5'- TGAGAACACTCCATGTAGCTCTG -3'
Posted On2013-04-24