Incidental Mutation 'R0381:Ccdc66'
List |< first << previous [record 5 of 34] next >> last >|
ID30982
Institutional Source Beutler Lab
Gene Symbol Ccdc66
Ensembl Gene ENSMUSG00000046753
Gene Namecoiled-coil domain containing 66
SynonymsE230015L20Rik
MMRRC Submission 038587-MU
Accession Numbers

Genbank: NM_177111.3; Ensembl: ENSMUST00000050480

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27481090-27508460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27491933 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 471 (Q471L)
Ref Sequence ENSEMBL: ENSMUSP00000153023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050480] [ENSMUST00000223689]
Predicted Effect probably damaging
Transcript: ENSMUST00000050480
AA Change: Q315L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052546
Gene: ENSMUSG00000046753
AA Change: Q315L

DomainStartEndE-ValueType
coiled coil region 252 284 N/A INTRINSIC
Pfam:CCDC66 409 561 1e-49 PFAM
low complexity region 715 721 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157990
Predicted Effect probably damaging
Transcript: ENSMUST00000223689
AA Change: Q471L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display slowly progressing photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Ccdc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ccdc66 APN 14 27498456 missense probably damaging 1.00
IGL01333:Ccdc66 APN 14 27493315 missense possibly damaging 0.60
IGL01684:Ccdc66 APN 14 27500249 missense possibly damaging 0.66
IGL02327:Ccdc66 APN 14 27493386 missense probably damaging 1.00
IGL02668:Ccdc66 APN 14 27497341 missense possibly damaging 0.94
IGL02698:Ccdc66 APN 14 27490792 nonsense probably null
IGL03293:Ccdc66 APN 14 27490671 missense probably damaging 1.00
1mM(1):Ccdc66 UTSW 14 27498775 missense possibly damaging 0.75
IGL02796:Ccdc66 UTSW 14 27486566 missense possibly damaging 0.93
R0374:Ccdc66 UTSW 14 27498473 missense probably damaging 1.00
R0498:Ccdc66 UTSW 14 27500240 critical splice donor site probably null
R0831:Ccdc66 UTSW 14 27497356 missense probably benign 0.00
R0969:Ccdc66 UTSW 14 27497362 missense probably damaging 0.98
R1558:Ccdc66 UTSW 14 27486506 missense probably benign 0.41
R2203:Ccdc66 UTSW 14 27486833 missense probably benign 0.03
R4015:Ccdc66 UTSW 14 27483836 missense probably damaging 1.00
R4225:Ccdc66 UTSW 14 27490779 missense probably damaging 1.00
R4584:Ccdc66 UTSW 14 27500511 missense probably benign 0.31
R4600:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4601:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4603:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4610:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4611:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4832:Ccdc66 UTSW 14 27500567 missense probably benign 0.00
R5098:Ccdc66 UTSW 14 27498793 missense probably damaging 1.00
R5322:Ccdc66 UTSW 14 27482527 missense probably damaging 1.00
R5586:Ccdc66 UTSW 14 27506711 missense probably damaging 1.00
R5681:Ccdc66 UTSW 14 27486741 missense probably benign 0.07
R5788:Ccdc66 UTSW 14 27498491 missense probably benign 0.10
R5790:Ccdc66 UTSW 14 27500447 missense possibly damaging 0.62
R6329:Ccdc66 UTSW 14 27486484 missense probably benign 0.20
R7171:Ccdc66 UTSW 14 27493272 missense possibly damaging 0.94
R7268:Ccdc66 UTSW 14 27486923 missense probably benign 0.24
R7337:Ccdc66 UTSW 14 27500333 missense probably damaging 1.00
R7348:Ccdc66 UTSW 14 27500336 missense probably damaging 1.00
R7552:Ccdc66 UTSW 14 27498863 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCTGTAATGTCTCTCCATGCAGCC -3'
(R):5'- CAGTGAAAAGCTGAGAGCTTCTCCC -3'

Sequencing Primer
(F):5'- TTCAGAATACAGACCTCGGTCTC -3'
(R):5'- CATCTCTCAGGCAGCGTG -3'
Posted On2013-04-24