Mutagenetix > Incidental Mutation

Incidental Mutation 'R3746:Abcb5'

309822

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

040732-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R3746 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118874620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1069 (D1069G)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably damaging
Transcript: ENSMUST00000035515
AA Change: D1069G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: D1069G

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Meta Mutation Damage Score

0.7777

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Ago1	A	G	4: 126,461,044	I125T	probably benign	Het
Ccdc40	T	C	11: 119,264,426	V1164A	probably benign	Het
Chd7	G	A	4: 8,752,537	V345M	probably damaging	Het
Cln6	A	G	9: 62,847,002	I109V	probably benign	Het
Csmd3	A	T	15: 47,849,766	F1604Y	probably benign	Het
Cx3cr1	T	C	9: 120,052,066	H90R	probably damaging	Het
Dip2c	A	T	13: 9,601,473	D674V	probably damaging	Het
Dnah17	T	C	11: 118,082,916	S1935G	probably benign	Het
Eif3g	G	A	9: 20,894,697	R295C	probably benign	Het
Epha5	T	C	5: 84,059,104	K998E	probably damaging	Het
Fam171b	A	T	2: 83,879,600	T539S	probably damaging	Het
Fer1l4	G	T	2: 156,035,048	H1159N	probably benign	Het
Fsip1	A	G	2: 118,233,050	C313R	probably damaging	Het
Gm12800	T	A	4: 101,909,876	D107E	possibly damaging	Het
Gm37240	T	G	3: 84,519,612	N168T	probably benign	Het
Gm7589	T	C	9: 59,145,855		noncoding transcript	Het
Igkv20-101-2	A	T	6: 68,474,958	I66L	possibly damaging	Het
Irf3	T	C	7: 44,998,873	F54S	probably damaging	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Lrp10	A	T	14: 54,469,266	N520I	possibly damaging	Het
Map3k21	A	G	8: 125,935,100	K479E	probably damaging	Het
Mpdz	A	C	4: 81,363,147	V609G	probably damaging	Het
Olfr65	T	A	7: 103,907,060	M207K	probably benign	Het
Opcml	G	A	9: 28,901,530	V173M	possibly damaging	Het
Osbpl7	T	C	11: 97,056,053	V223A	probably damaging	Het
Pcdh17	A	T	14: 84,533,037	Y985F	probably benign	Het
Piezo1	G	T	8: 122,492,638	F1084L	probably damaging	Het
Pkhd1	A	G	1: 20,058,300	*4060Q	probably null	Het
Plekhn1	T	C	4: 156,225,594	T88A	probably benign	Het
Rmdn2	T	A	17: 79,670,552		probably null	Het
Selenom	A	G	11: 3,517,132	E137G	probably benign	Het
Slc38a7	A	G	8: 95,843,752		probably benign	Het
Slc39a12	T	C	2: 14,396,067		probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Supt16	A	G	14: 52,180,139	L306P	probably damaging	Het
Tas2r136	A	T	6: 132,777,237	F309Y	probably damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trim63	G	A	4: 134,315,354	C44Y	probably damaging	Het
Ush2a	G	A	1: 188,810,292	G3352S	probably benign	Het
Vmn1r4	A	G	6: 56,957,131	R207G	probably damaging	Het
Vmn2r76	A	G	7: 86,225,555	V738A	probably benign	Het
Vwa5b2	A	G	16: 20,598,326		probably benign	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCACCAGTTTTGTTGTGG -3'
(R):5'- GGGTGCAACTTTCCTATGTCCAC -3'

Sequencing Primer
(F):5'- GGGCTGCTGTTCCTTAGGTAG -3'
(R):5'- TATGTCCACTGTAAACACTGCC -3'

Posted On

2015-04-17