Incidental Mutation 'R3747:Ago1'
ID 309851
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
Accession Numbers
Essential gene? Probably essential (E-score: 0.810) question?
Stock # R3747 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 126328805-126362376 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126354837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: I125T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I125T

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000127800
AA Change: I47T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149425
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,036,501 (GRCm39) E347* probably null Het
Abhd18 A G 3: 40,888,008 (GRCm39) N284S probably benign Het
Adam12 T C 7: 133,774,594 (GRCm39) D5G probably damaging Het
Adam26b A C 8: 43,974,234 (GRCm39) V256G probably benign Het
Aga T A 8: 53,970,856 (GRCm39) I192N probably benign Het
Alk A G 17: 72,218,560 (GRCm39) S762P probably damaging Het
Bckdk C A 7: 127,504,590 (GRCm39) R105S probably damaging Het
Cby3 T C 11: 50,250,501 (GRCm39) *236R probably null Het
Cfhr1 C A 1: 139,485,372 (GRCm39) probably null Het
Clcn1 T A 6: 42,276,849 (GRCm39) Y393N probably damaging Het
Cx3cr1 T C 9: 119,881,132 (GRCm39) H90R probably damaging Het
Cyp3a16 T A 5: 145,378,881 (GRCm39) K380M probably damaging Het
Cyp4v3 G A 8: 45,768,745 (GRCm39) R272* probably null Het
Dazap1 C T 10: 80,123,498 (GRCm39) R391C possibly damaging Het
Dgkh T A 14: 78,821,885 (GRCm39) E876V probably damaging Het
Dnah8 A T 17: 31,003,148 (GRCm39) K3616* probably null Het
E2f1 C G 2: 154,405,942 (GRCm39) G144R probably damaging Het
Fam221a A G 6: 49,349,630 (GRCm39) D2G probably damaging Het
Fam43a C T 16: 30,420,664 (GRCm39) T416I probably benign Het
Fam90a1a C A 8: 22,453,221 (GRCm39) S192* probably null Het
Foxd1 G C 13: 98,492,424 (GRCm39) A433P unknown Het
Garin4 T G 1: 190,896,207 (GRCm39) Q145H probably damaging Het
Gm10152 G A 7: 144,316,937 (GRCm39) probably null Het
Hipk3 T A 2: 104,271,628 (GRCm39) R435* probably null Het
Hnrnpab T A 11: 51,493,473 (GRCm39) Y245F probably benign Het
Islr2 A T 9: 58,106,925 (GRCm39) S112T probably benign Het
Itgb7 A T 15: 102,131,212 (GRCm39) V280D probably damaging Het
Kndc1 G A 7: 139,507,817 (GRCm39) probably null Het
Lrba T G 3: 86,283,260 (GRCm39) L1858R probably damaging Het
Mroh2b G A 15: 4,981,728 (GRCm39) W1513* probably null Het
Nbeal1 A G 1: 60,234,182 (GRCm39) D51G probably damaging Het
Ncoa6 G A 2: 155,253,561 (GRCm39) P939L probably benign Het
Ndst3 A G 3: 123,465,201 (GRCm39) I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,069,795 (GRCm39) probably benign Het
Nuf2 T A 1: 169,352,945 (GRCm39) N20I probably damaging Het
Osbpl7 T C 11: 96,946,879 (GRCm39) V223A probably damaging Het
Pcm1 T C 8: 41,785,041 (GRCm39) I2064T probably benign Het
Pkd1 A G 17: 24,810,435 (GRCm39) R90G possibly damaging Het
Pkdrej T A 15: 85,705,278 (GRCm39) K219N probably damaging Het
Ppil4 A T 10: 7,690,457 (GRCm39) Q370L probably benign Het
Pramel18 T A 4: 101,767,073 (GRCm39) D107E possibly damaging Het
Primpol A T 8: 47,052,848 (GRCm39) D154E probably benign Het
Rb1cc1 T G 1: 6,318,966 (GRCm39) V778G possibly damaging Het
Sgms1 A T 19: 32,136,994 (GRCm39) S191T possibly damaging Het
Sned1 T A 1: 93,189,473 (GRCm39) F303Y probably damaging Het
Sp9 T A 2: 73,104,652 (GRCm39) M402K probably damaging Het
Spon1 T C 7: 113,365,621 (GRCm39) L19P probably damaging Het
Spon1 T A 7: 113,616,024 (GRCm39) V297E possibly damaging Het
Tlr5 T C 1: 182,802,004 (GRCm39) I436T probably benign Het
Tmem63a G A 1: 180,790,679 (GRCm39) D446N possibly damaging Het
Tpcn2 T C 7: 144,809,260 (GRCm39) H682R probably damaging Het
Ugt1a6a T C 1: 88,066,871 (GRCm39) Y226H probably damaging Het
Upf1 G T 8: 70,786,000 (GRCm39) N975K possibly damaging Het
Ush2a G A 1: 188,542,489 (GRCm39) G3352S probably benign Het
Vmn1r39 T C 6: 66,781,854 (GRCm39) N155D probably benign Het
Vwa5b2 A G 16: 20,417,076 (GRCm39) probably benign Het
Yipf4 G A 17: 74,803,667 (GRCm39) probably null Het
Zdhhc17 T C 10: 110,780,281 (GRCm39) I624M probably benign Het
Zfhx4 G A 3: 5,308,225 (GRCm39) E484K possibly damaging Het
Zswim4 G A 8: 84,938,676 (GRCm39) P1069S possibly damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,353,610 (GRCm39) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,333,324 (GRCm39) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,347,433 (GRCm39) nonsense probably null
IGL02810:Ago1 APN 4 126,336,886 (GRCm39) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,355,587 (GRCm39) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,352,982 (GRCm39) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,336,964 (GRCm39) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,353,796 (GRCm39) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,357,484 (GRCm39) missense probably benign 0.01
R0244:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126,336,959 (GRCm39) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,333,388 (GRCm39) missense probably benign
R0557:Ago1 UTSW 4 126,353,817 (GRCm39) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,347,426 (GRCm39) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,334,194 (GRCm39) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,357,534 (GRCm39) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,333,788 (GRCm39) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,335,029 (GRCm39) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,348,187 (GRCm39) missense probably null 0.36
R2051:Ago1 UTSW 4 126,354,246 (GRCm39) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,355,581 (GRCm39) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,357,650 (GRCm39) splice site probably null
R2256:Ago1 UTSW 4 126,335,704 (GRCm39) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,347,443 (GRCm39) missense probably benign 0.01
R2517:Ago1 UTSW 4 126,333,732 (GRCm39) nonsense probably null
R2850:Ago1 UTSW 4 126,336,868 (GRCm39) splice site probably benign
R2993:Ago1 UTSW 4 126,333,839 (GRCm39) splice site probably benign
R3746:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3750:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R4600:Ago1 UTSW 4 126,354,185 (GRCm39) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,342,652 (GRCm39) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,347,447 (GRCm39) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,347,397 (GRCm39) missense probably benign 0.01
R5132:Ago1 UTSW 4 126,355,516 (GRCm39) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,335,008 (GRCm39) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,354,830 (GRCm39) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,342,587 (GRCm39) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,354,362 (GRCm39) unclassified probably benign
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,342,601 (GRCm39) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,357,628 (GRCm39) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,348,145 (GRCm39) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,354,215 (GRCm39) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,333,298 (GRCm39) makesense probably null
R7496:Ago1 UTSW 4 126,355,545 (GRCm39) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,347,701 (GRCm39) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,337,022 (GRCm39) missense probably benign 0.18
R7988:Ago1 UTSW 4 126,354,210 (GRCm39) missense probably damaging 1.00
R8041:Ago1 UTSW 4 126,335,729 (GRCm39) missense probably damaging 1.00
R8073:Ago1 UTSW 4 126,337,019 (GRCm39) missense probably benign 0.04
R8086:Ago1 UTSW 4 126,354,774 (GRCm39) missense probably benign
R8127:Ago1 UTSW 4 126,348,214 (GRCm39) missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126,354,316 (GRCm39) unclassified probably benign
R8878:Ago1 UTSW 4 126,357,516 (GRCm39) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,357,583 (GRCm39) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,336,977 (GRCm39) missense probably benign
X0025:Ago1 UTSW 4 126,336,908 (GRCm39) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,347,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTTACCAACACTGTCG -3'
(R):5'- AAGCACTGGGGCATCATCTG -3'

Sequencing Primer
(F):5'- GCAGTTTTACCAACACTGTCGCTTAG -3'
(R):5'- AAGTACACTGTAGCTGTCTTCAGGC -3'
Posted On 2015-04-17