Incidental Mutation 'R0381:Vmn2r104'
ID30988
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Namevomeronasal 2, receptor 104
SynonymsV2r7
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20029425-20048205 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 20048002 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 68 (Y68*)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
Predicted Effect probably null
Transcript: ENSMUST00000168050
AA Change: Y68*
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: Y68*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20040778 missense possibly damaging 0.55
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCACAAAAGAGTGACACCATCT -3'
(R):5'- CGCATGGCTCTTGCAGAATCACAAA -3'

Sequencing Primer
(F):5'- agtgggggaaggagtgg -3'
(R):5'- CTCTTGCAGAATCACAAAGTTTCC -3'
Posted On2013-04-24