Mutagenetix > Incidental Mutations

Incidental Mutation 'R0381:Vmn2r104'

30988

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

038587-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R0381 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 20048002 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 68 (Y68*)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

Predicted Effect

probably null
Transcript: ENSMUST00000168050
AA Change: Y68*

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: Y68*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.4%
10x: 96.5%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,108,434	V1297A	possibly damaging	Het
Agbl2	C	T	2: 90,784,098	H25Y	probably damaging	Het
Akap11	A	T	14: 78,513,550	W466R	probably benign	Het
BC048403	T	C	10: 121,745,375	Y94H	probably damaging	Het
Ccdc66	T	A	14: 27,491,933	Q471L	probably damaging	Het
Dennd1c	G	A	17: 57,073,822	A210V	probably damaging	Het
F13b	A	G	1: 139,510,859	K334E	probably damaging	Het
Fam186a	A	C	15: 99,942,174	I2063R	probably damaging	Het
Fcrl5	T	C	3: 87,446,460	Y371H	probably damaging	Het
Fnbp1	C	T	2: 31,033,029	G549D	probably benign	Het
Fndc3a	A	G	14: 72,556,627	Y869H	probably benign	Het
Gm7592	A	G	1: 85,526,716		noncoding transcript	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Hmcn1	C	T	1: 150,603,811	C4634Y	probably damaging	Het
Kctd5	A	G	17: 24,059,220		probably null	Het
Mettl24	C	A	10: 40,746,390	H203N	probably damaging	Het
Mitf	A	G	6: 97,993,143	E17G	probably damaging	Het
Mrc1	G	A	2: 14,307,909	D881N	probably benign	Het
Mrm1	T	C	11: 84,818,683	T183A	possibly damaging	Het
Mut	T	A	17: 40,937,258	W59R	probably benign	Het
Mylk	G	A	16: 34,784,974		probably null	Het
Nab2	G	A	10: 127,665,067	A19V	probably damaging	Het
Ntsr2	T	A	12: 16,659,718	Y333*	probably null	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Sypl2	T	C	3: 108,226,157	E32G	possibly damaging	Het
Tasp1	T	C	2: 139,951,483	K258E	probably damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tenm4	G	T	7: 96,905,881	V2561F	probably damaging	Het
Tmc1	T	C	19: 20,799,045	Y650C	probably damaging	Het
Trim34b	T	C	7: 104,329,855	L103P	probably damaging	Het
Usp47	T	C	7: 112,063,393		probably null	Het
Vmn1r201	T	A	13: 22,475,023	W136R	probably damaging	Het
Wscd2	T	A	5: 113,551,131	L66Q	probably damaging	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCACAAAAGAGTGACACCATCT -3'
(R):5'- CGCATGGCTCTTGCAGAATCACAAA -3'

Sequencing Primer
(F):5'- agtgggggaaggagtgg -3'
(R):5'- CTCTTGCAGAATCACAAAGTTTCC -3'

Posted On

2013-04-24