Incidental Mutation 'R3747:Nolc1'
ID 309904
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Name nucleolar and coiled-body phosphoprotein 1
Synonyms 3230402K17Rik, P130, NOPP140
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3747 (G1)
Quality Score 119
Status Not validated
Chromosome 19
Chromosomal Location 46064302-46073969 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGAAG at 46069795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000225780] [ENSMUST00000224490]
AlphaFold E9Q5C9
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,036,501 (GRCm39) E347* probably null Het
Abhd18 A G 3: 40,888,008 (GRCm39) N284S probably benign Het
Adam12 T C 7: 133,774,594 (GRCm39) D5G probably damaging Het
Adam26b A C 8: 43,974,234 (GRCm39) V256G probably benign Het
Aga T A 8: 53,970,856 (GRCm39) I192N probably benign Het
Ago1 A G 4: 126,354,837 (GRCm39) I125T probably benign Het
Alk A G 17: 72,218,560 (GRCm39) S762P probably damaging Het
Bckdk C A 7: 127,504,590 (GRCm39) R105S probably damaging Het
Cby3 T C 11: 50,250,501 (GRCm39) *236R probably null Het
Cfhr1 C A 1: 139,485,372 (GRCm39) probably null Het
Clcn1 T A 6: 42,276,849 (GRCm39) Y393N probably damaging Het
Cx3cr1 T C 9: 119,881,132 (GRCm39) H90R probably damaging Het
Cyp3a16 T A 5: 145,378,881 (GRCm39) K380M probably damaging Het
Cyp4v3 G A 8: 45,768,745 (GRCm39) R272* probably null Het
Dazap1 C T 10: 80,123,498 (GRCm39) R391C possibly damaging Het
Dgkh T A 14: 78,821,885 (GRCm39) E876V probably damaging Het
Dnah8 A T 17: 31,003,148 (GRCm39) K3616* probably null Het
E2f1 C G 2: 154,405,942 (GRCm39) G144R probably damaging Het
Fam221a A G 6: 49,349,630 (GRCm39) D2G probably damaging Het
Fam43a C T 16: 30,420,664 (GRCm39) T416I probably benign Het
Fam90a1a C A 8: 22,453,221 (GRCm39) S192* probably null Het
Foxd1 G C 13: 98,492,424 (GRCm39) A433P unknown Het
Garin4 T G 1: 190,896,207 (GRCm39) Q145H probably damaging Het
Gm10152 G A 7: 144,316,937 (GRCm39) probably null Het
Hipk3 T A 2: 104,271,628 (GRCm39) R435* probably null Het
Hnrnpab T A 11: 51,493,473 (GRCm39) Y245F probably benign Het
Islr2 A T 9: 58,106,925 (GRCm39) S112T probably benign Het
Itgb7 A T 15: 102,131,212 (GRCm39) V280D probably damaging Het
Kndc1 G A 7: 139,507,817 (GRCm39) probably null Het
Lrba T G 3: 86,283,260 (GRCm39) L1858R probably damaging Het
Mroh2b G A 15: 4,981,728 (GRCm39) W1513* probably null Het
Nbeal1 A G 1: 60,234,182 (GRCm39) D51G probably damaging Het
Ncoa6 G A 2: 155,253,561 (GRCm39) P939L probably benign Het
Ndst3 A G 3: 123,465,201 (GRCm39) I257T probably benign Het
Nuf2 T A 1: 169,352,945 (GRCm39) N20I probably damaging Het
Osbpl7 T C 11: 96,946,879 (GRCm39) V223A probably damaging Het
Pcm1 T C 8: 41,785,041 (GRCm39) I2064T probably benign Het
Pkd1 A G 17: 24,810,435 (GRCm39) R90G possibly damaging Het
Pkdrej T A 15: 85,705,278 (GRCm39) K219N probably damaging Het
Ppil4 A T 10: 7,690,457 (GRCm39) Q370L probably benign Het
Pramel18 T A 4: 101,767,073 (GRCm39) D107E possibly damaging Het
Primpol A T 8: 47,052,848 (GRCm39) D154E probably benign Het
Rb1cc1 T G 1: 6,318,966 (GRCm39) V778G possibly damaging Het
Sgms1 A T 19: 32,136,994 (GRCm39) S191T possibly damaging Het
Sned1 T A 1: 93,189,473 (GRCm39) F303Y probably damaging Het
Sp9 T A 2: 73,104,652 (GRCm39) M402K probably damaging Het
Spon1 T C 7: 113,365,621 (GRCm39) L19P probably damaging Het
Spon1 T A 7: 113,616,024 (GRCm39) V297E possibly damaging Het
Tlr5 T C 1: 182,802,004 (GRCm39) I436T probably benign Het
Tmem63a G A 1: 180,790,679 (GRCm39) D446N possibly damaging Het
Tpcn2 T C 7: 144,809,260 (GRCm39) H682R probably damaging Het
Ugt1a6a T C 1: 88,066,871 (GRCm39) Y226H probably damaging Het
Upf1 G T 8: 70,786,000 (GRCm39) N975K possibly damaging Het
Ush2a G A 1: 188,542,489 (GRCm39) G3352S probably benign Het
Vmn1r39 T C 6: 66,781,854 (GRCm39) N155D probably benign Het
Vwa5b2 A G 16: 20,417,076 (GRCm39) probably benign Het
Yipf4 G A 17: 74,803,667 (GRCm39) probably null Het
Zdhhc17 T C 10: 110,780,281 (GRCm39) I624M probably benign Het
Zfhx4 G A 3: 5,308,225 (GRCm39) E484K possibly damaging Het
Zswim4 G A 8: 84,938,676 (GRCm39) P1069S possibly damaging Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46,071,468 (GRCm39) unclassified probably benign
FR4976:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
FR4976:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R0106:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R0121:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0140:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0501:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46,072,598 (GRCm39) missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R1553:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
R1642:Nolc1 UTSW 19 46,067,461 (GRCm39) critical splice donor site probably null
R1698:Nolc1 UTSW 19 46,069,870 (GRCm39) splice site probably null
R2067:Nolc1 UTSW 19 46,072,046 (GRCm39) missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46,069,800 (GRCm39) small insertion probably benign
R2113:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,807 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2895:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R2999:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R3737:Nolc1 UTSW 19 46,069,816 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,792 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,809 (GRCm39) small insertion probably benign
R3806:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
R4035:Nolc1 UTSW 19 46,069,797 (GRCm39) small insertion probably benign
R4619:Nolc1 UTSW 19 46,071,959 (GRCm39) missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R4999:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46,070,103 (GRCm39) nonsense probably null
R5559:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R5837:Nolc1 UTSW 19 46,071,622 (GRCm39) unclassified probably benign
R6457:Nolc1 UTSW 19 46,071,509 (GRCm39) unclassified probably benign
R7467:Nolc1 UTSW 19 46,070,773 (GRCm39) missense unknown
R7497:Nolc1 UTSW 19 46,071,257 (GRCm39) missense probably benign 0.23
R8011:Nolc1 UTSW 19 46,070,023 (GRCm39) missense unknown
R8806:Nolc1 UTSW 19 46,071,471 (GRCm39) missense unknown
RF027:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF031:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF034:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF040:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF044:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
X0050:Nolc1 UTSW 19 46,069,791 (GRCm39) small deletion probably benign
Y5377:Nolc1 UTSW 19 46,069,808 (GRCm39) small insertion probably benign
Y5379:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
Z1088:Nolc1 UTSW 19 46,071,537 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTCATCCTTTACCTGCTAAGC -3'
(R):5'- CTACTTTCACTGGGGCCTTG -3'

Sequencing Primer
(F):5'- TGCTAAGCCATCCCACCTG -3'
(R):5'- TGGTACAGTCTTCATTGGAGAG -3'
Posted On 2015-04-17