Incidental Mutation 'R0382:Uap1'
Institutional Source Beutler Lab
Gene Symbol Uap1
Ensembl Gene ENSMUSG00000026670
Gene NameUDP-N-acetylglucosamine pyrophosphorylase 1
SynonymsESTM38, SPAG2, AgX, AGX1
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R0382 (G1)
Quality Score220
Status Validated
Chromosomal Location170141938-170174957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 170161482 bp
Amino Acid Change Methionine to Leucine at position 124 (M124L)
Ref Sequence ENSEMBL: ENSMUSP00000106982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027981] [ENSMUST00000111350] [ENSMUST00000111351]
Predicted Effect probably benign
Transcript: ENSMUST00000027981
AA Change: M124L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027981
Gene: ENSMUSG00000026670
AA Change: M124L

Pfam:UDPGP 44 471 2e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111350
AA Change: M124L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106982
Gene: ENSMUSG00000026670
AA Change: M124L

Pfam:UDPGP 44 467 5.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111351
AA Change: M124L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106983
Gene: ENSMUSG00000026670
AA Change: M124L

Pfam:UDPGP 45 472 4.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191797
Meta Mutation Damage Score 0.0810 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Uap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Uap1 APN 1 170166712 missense probably benign 0.22
IGL02330:Uap1 APN 1 170150327 missense possibly damaging 0.94
IGL03383:Uap1 APN 1 170158891 missense probably damaging 1.00
R0696:Uap1 UTSW 1 170149274 missense probably benign 0.23
R1055:Uap1 UTSW 1 170156911 splice site probably benign
R1463:Uap1 UTSW 1 170150383 missense probably benign
R1522:Uap1 UTSW 1 170150941 critical splice donor site probably null
R2257:Uap1 UTSW 1 170158743 splice site probably benign
R4061:Uap1 UTSW 1 170158846 missense possibly damaging 0.71
R4533:Uap1 UTSW 1 170143425 missense probably damaging 1.00
R5068:Uap1 UTSW 1 170161463 missense probably damaging 0.98
R5341:Uap1 UTSW 1 170143431 missense probably damaging 1.00
R5712:Uap1 UTSW 1 170166845 missense possibly damaging 0.87
R5772:Uap1 UTSW 1 170161380 missense probably benign 0.20
R5869:Uap1 UTSW 1 170151138 critical splice acceptor site probably null
R6229:Uap1 UTSW 1 170166733 missense probably benign
R7216:Uap1 UTSW 1 170158903 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- actgaacttggtccctcttg -3'
Posted On2013-04-24