Incidental Mutation 'R3748:Adam26b'
ID309923
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission 040733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3748 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43521197 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 256 (V256G)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably benign
Transcript: ENSMUST00000080135
AA Change: V256G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: V256G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,765,750 C14R probably benign Het
2310003L06Rik A G 5: 87,964,563 probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca13 T C 11: 9,316,119 probably benign Het
Acaca A G 11: 84,311,409 probably null Het
Adam2 C T 14: 66,059,912 V182I probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cmss1 T C 16: 57,302,272 E253G probably damaging Het
Csmd1 T G 8: 15,906,071 N3379H probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Golgb1 G C 16: 36,918,912 D2538H probably benign Het
Hoxc12 A G 15: 102,938,378 E235G probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mfsd4b4 A G 10: 39,894,136 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nrp1 T C 8: 128,457,980 W369R probably damaging Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Olfr525 T C 7: 140,323,128 L143P possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Tdh T C 14: 63,495,993 T149A probably benign Het
Tnip3 C T 6: 65,614,763 L249F probably damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vmn2r27 T C 6: 124,230,392 I97V probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7596:Adam26b UTSW 8 43520200 missense probably benign
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7769:Adam26b UTSW 8 43521695 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7993:Adam26b UTSW 8 43520208 missense probably benign 0.13
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATGTGTGCCATGTCTGACATTAC -3'
(R):5'- TGGACCCACCACAGGTTTATTG -3'

Sequencing Primer
(F):5'- GTGTGCCATGTCTGACATTACATCAG -3'
(R):5'- CCACCACAGGTTTATTGAATATTTTG -3'
Posted On2015-04-17