Incidental Mutation 'R3748:Cyp4v3'
ID 309924
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Name cytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission 040733-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3748 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 45304944-45333216 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 45315708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 272 (R272*)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095328]
AlphaFold Q9DBW0
Predicted Effect probably null
Transcript: ENSMUST00000095328
AA Change: R272*
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: R272*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,765,750 C14R probably benign Het
2310003L06Rik A G 5: 87,964,563 probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca13 T C 11: 9,316,119 probably benign Het
Acaca A G 11: 84,311,409 probably null Het
Adam2 C T 14: 66,059,912 V182I probably benign Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cmss1 T C 16: 57,302,272 E253G probably damaging Het
Csmd1 T G 8: 15,906,071 N3379H probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Golgb1 G C 16: 36,918,912 D2538H probably benign Het
Hoxc12 A G 15: 102,938,378 E235G probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mfsd4b4 A G 10: 39,894,136 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nrp1 T C 8: 128,457,980 W369R probably damaging Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Olfr525 T C 7: 140,323,128 L143P possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Tdh T C 14: 63,495,993 T149A probably benign Het
Tnip3 C T 6: 65,614,763 L249F probably damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vmn2r27 T C 6: 124,230,392 I97V probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45307003 missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45307021 missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45320615 missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45308374 splice site probably null
IGL02565:Cyp4v3 APN 8 45320637 missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45308716 missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45308651 unclassified probably benign
R1818:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45306952 missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45317776 missense probably benign
R3747:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3750:Cyp4v3 UTSW 8 45315708 nonsense probably null
R4289:Cyp4v3 UTSW 8 45328223 missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45306992 missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45320637 missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45306980 missense probably damaging 1.00
R5479:Cyp4v3 UTSW 8 45310206 missense probably benign 0.00
R5667:Cyp4v3 UTSW 8 45308535 missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45321784 missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45320160 missense probably damaging 1.00
R6470:Cyp4v3 UTSW 8 45317736 nonsense probably null
R6592:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R6700:Cyp4v3 UTSW 8 45307093 missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45310252 missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45321750 missense probably benign 0.01
R7966:Cyp4v3 UTSW 8 45332917 missense probably benign 0.44
R8331:Cyp4v3 UTSW 8 45315708 nonsense probably null
R8886:Cyp4v3 UTSW 8 45321748 nonsense probably null
R8955:Cyp4v3 UTSW 8 45308527 missense probably benign 0.00
R8957:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R9718:Cyp4v3 UTSW 8 45320666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCATGAGTACATCCTGAG -3'
(R):5'- TTAACCAGAGGCCTTGGTGC -3'

Sequencing Primer
(F):5'- CCATGAGTACATCCTGAGTTGTG -3'
(R):5'- CTGAGAAAGTATCAGGTGGG -3'
Posted On 2015-04-17