Mutagenetix > Incidental Mutation

Incidental Mutation 'R3748:Upf1'

309926

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040733-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R3748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70333350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 975 (N975K)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075666
AA Change: N986K

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: N986K

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140239

SMART Domains

Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

Domain	Start	End	E-Value	Type
low complexity region	49	68	N/A	INTRINSIC
TLC	97	311	1.24e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165819

SMART Domains

Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:TGFb_propeptide	33	169	7e-16	PFAM
low complexity region	225	237	N/A	INTRINSIC
TGFB	251	357	6.22e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207684

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215817
AA Change: N975K

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.0742

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	A	G	9: 50,765,750	C14R	probably benign	Het
2310003L06Rik	A	G	5: 87,964,563		probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca13	T	C	11: 9,316,119		probably benign	Het
Acaca	A	G	11: 84,311,409		probably null	Het
Adam2	C	T	14: 66,059,912	V182I	probably benign	Het
Adam26b	A	C	8: 43,521,197	V256G	probably benign	Het
Cfhr1	C	A	1: 139,557,634		probably null	Het
Clcn1	T	A	6: 42,299,915	Y393N	probably damaging	Het
Cmss1	T	C	16: 57,302,272	E253G	probably damaging	Het
Csmd1	T	G	8: 15,906,071	N3379H	probably damaging	Het
Cx3cr1	T	C	9: 120,052,066	H90R	probably damaging	Het
Cyp4v3	G	A	8: 45,315,708	R272*	probably null	Het
Daam1	C	A	12: 71,971,166	D716E	probably damaging	Het
Dnah8	A	T	17: 30,784,174	K3616*	probably null	Het
Fam221a	A	G	6: 49,372,696	D2G	probably damaging	Het
Golgb1	G	C	16: 36,918,912	D2538H	probably benign	Het
Hoxc12	A	G	15: 102,938,378	E235G	probably damaging	Het
Lrba	T	G	3: 86,375,953	L1858R	probably damaging	Het
Mfsd4b4	A	G	10: 39,894,136		probably benign	Het
Mroh2b	G	A	15: 4,952,246	W1513*	probably null	Het
Nrp1	T	C	8: 128,457,980	W369R	probably damaging	Het
Nuf2	T	A	1: 169,525,376	N20I	probably damaging	Het
Olfr525	T	C	7: 140,323,128	L143P	possibly damaging	Het
Pkdrej	T	A	15: 85,821,077	K219N	probably damaging	Het
Primpol	A	T	8: 46,599,813	D154E	probably benign	Het
Slk	T	G	19: 47,619,809	D400E	possibly damaging	Het
Tdh	T	C	14: 63,495,993	T149A	probably benign	Het
Tnip3	C	T	6: 65,614,763	L249F	probably damaging	Het
Tpcn2	T	C	7: 145,255,523	H682R	probably damaging	Het
Vmn1r39	T	C	6: 66,804,870	N155D	probably benign	Het
Vmn2r27	T	C	6: 124,230,392	I97V	probably benign	Het
Zfhx4	G	A	3: 5,243,165	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,212,047	P1069S	possibly damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACACGTAACCCTGTGTGAGG -3'
(R):5'- TGCATGTCAAGACACACTCG -3'

Sequencing Primer
(F):5'- CAAAGCGGTTCTTCTGGCG -3'
(R):5'- GACACACTCGACCTCCCTACTTG -3'

Posted On

2015-04-17