Incidental Mutation 'R3748:Zswim4'
ID309928
Institutional Source Beutler Lab
Gene Symbol Zswim4
Ensembl Gene ENSMUSG00000035671
Gene Namezinc finger SWIM-type containing 4
SynonymsE130119J17Rik
MMRRC Submission 040733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R3748 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84210678-84237055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84212047 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1069 (P1069S)
Ref Sequence ENSEMBL: ENSMUSP00000040078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039480
AA Change: P1069S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671
AA Change: P1069S

DomainStartEndE-ValueType
low complexity region 531 545 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199621
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,765,750 C14R probably benign Het
2310003L06Rik A G 5: 87,964,563 probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca13 T C 11: 9,316,119 probably benign Het
Acaca A G 11: 84,311,409 probably null Het
Adam2 C T 14: 66,059,912 V182I probably benign Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cmss1 T C 16: 57,302,272 E253G probably damaging Het
Csmd1 T G 8: 15,906,071 N3379H probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Golgb1 G C 16: 36,918,912 D2538H probably benign Het
Hoxc12 A G 15: 102,938,378 E235G probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mfsd4b4 A G 10: 39,894,136 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nrp1 T C 8: 128,457,980 W369R probably damaging Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Olfr525 T C 7: 140,323,128 L143P possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Tdh T C 14: 63,495,993 T149A probably benign Het
Tnip3 C T 6: 65,614,763 L249F probably damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vmn2r27 T C 6: 124,230,392 I97V probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Zswim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Zswim4 APN 8 84212140 missense probably damaging 1.00
IGL03048:Zswim4 UTSW 8 84211975 missense possibly damaging 0.95
R0217:Zswim4 UTSW 8 84212664 missense probably damaging 1.00
R0688:Zswim4 UTSW 8 84228888 missense possibly damaging 0.93
R1217:Zswim4 UTSW 8 84219972 missense possibly damaging 0.89
R1853:Zswim4 UTSW 8 84224200 missense probably damaging 1.00
R1878:Zswim4 UTSW 8 84212776 missense possibly damaging 0.55
R2205:Zswim4 UTSW 8 84225869 missense possibly damaging 0.70
R2940:Zswim4 UTSW 8 84223748 missense probably damaging 1.00
R3747:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3750:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R4777:Zswim4 UTSW 8 84236957 missense probably benign
R4831:Zswim4 UTSW 8 84212319 missense probably damaging 1.00
R4959:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4968:Zswim4 UTSW 8 84217372 missense probably benign 0.37
R4973:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4977:Zswim4 UTSW 8 84226667 splice site probably null
R4978:Zswim4 UTSW 8 84226667 splice site probably null
R4980:Zswim4 UTSW 8 84226667 splice site probably null
R4981:Zswim4 UTSW 8 84226667 splice site probably null
R4982:Zswim4 UTSW 8 84226667 splice site probably null
R4983:Zswim4 UTSW 8 84226667 splice site probably null
R5248:Zswim4 UTSW 8 84219932 missense probably benign 0.13
R5337:Zswim4 UTSW 8 84235079 missense probably damaging 1.00
R5366:Zswim4 UTSW 8 84212790 missense probably benign 0.39
R5646:Zswim4 UTSW 8 84231110 splice site probably null
R5845:Zswim4 UTSW 8 84217242 splice site probably null
R6193:Zswim4 UTSW 8 84226145 missense probably benign
R6270:Zswim4 UTSW 8 84230951 missense probably damaging 1.00
R6648:Zswim4 UTSW 8 84230914 missense probably benign 0.22
R6920:Zswim4 UTSW 8 84214085 missense probably benign 0.01
R7117:Zswim4 UTSW 8 84214052 missense probably damaging 1.00
R7155:Zswim4 UTSW 8 84219927 missense probably damaging 1.00
R7344:Zswim4 UTSW 8 84223698 nonsense probably null
R7354:Zswim4 UTSW 8 84228849 missense probably damaging 1.00
R8036:Zswim4 UTSW 8 84223289 missense probably benign 0.22
R8408:Zswim4 UTSW 8 84212385 missense possibly damaging 0.82
R8518:Zswim4 UTSW 8 84211957 missense probably damaging 1.00
R8750:Zswim4 UTSW 8 84212684 missense possibly damaging 0.82
R8830:Zswim4 UTSW 8 84223316 missense possibly damaging 0.92
R8838:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R8840:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R8842:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTCTGCACACTCCTAGGC -3'
(R):5'- GCTACCAAACCACTAGGGACTG -3'

Sequencing Primer
(F):5'- ACTTTACTGCAAGTAGCCATGGG -3'
(R):5'- CACTAGGGACTGACAGGGCAC -3'
Posted On2015-04-17