Incidental Mutation 'R3748:Hoxc12'
ID309946
Institutional Source Beutler Lab
Gene Symbol Hoxc12
Ensembl Gene ENSMUSG00000050328
Gene Namehomeobox C12
SynonymsHox-3.8
MMRRC Submission 040733-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3748 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102936757-102938609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102938378 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 235 (E235G)
Ref Sequence ENSEMBL: ENSMUSP00000051003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055562]
Predicted Effect probably damaging
Transcript: ENSMUST00000055562
AA Change: E235G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051003
Gene: ENSMUSG00000050328
AA Change: E235G

DomainStartEndE-ValueType
low complexity region 101 129 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
HOX 212 274 1.05e-20 SMART
Meta Mutation Damage Score 0.2957 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,765,750 C14R probably benign Het
2310003L06Rik A G 5: 87,964,563 probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca13 T C 11: 9,316,119 probably benign Het
Acaca A G 11: 84,311,409 probably null Het
Adam2 C T 14: 66,059,912 V182I probably benign Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cmss1 T C 16: 57,302,272 E253G probably damaging Het
Csmd1 T G 8: 15,906,071 N3379H probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Golgb1 G C 16: 36,918,912 D2538H probably benign Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mfsd4b4 A G 10: 39,894,136 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nrp1 T C 8: 128,457,980 W369R probably damaging Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Olfr525 T C 7: 140,323,128 L143P possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Tdh T C 14: 63,495,993 T149A probably benign Het
Tnip3 C T 6: 65,614,763 L249F probably damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vmn2r27 T C 6: 124,230,392 I97V probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Hoxc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Hoxc12 APN 15 102937320 missense probably benign
IGL01978:Hoxc12 APN 15 102936864 missense probably damaging 1.00
PIT4531001:Hoxc12 UTSW 15 102938420 missense probably damaging 1.00
R0724:Hoxc12 UTSW 15 102937055 missense probably damaging 0.99
R4448:Hoxc12 UTSW 15 102938476 missense probably damaging 1.00
R5151:Hoxc12 UTSW 15 102938446 missense probably damaging 1.00
R6376:Hoxc12 UTSW 15 102937089 missense possibly damaging 0.77
R7034:Hoxc12 UTSW 15 102938360 missense probably damaging 0.99
R7036:Hoxc12 UTSW 15 102938360 missense probably damaging 0.99
R7096:Hoxc12 UTSW 15 102937038 missense possibly damaging 0.79
R7295:Hoxc12 UTSW 15 102938375 missense probably damaging 0.97
X0028:Hoxc12 UTSW 15 102937458 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACATTTTCAGGATGAGAAGCG -3'
(R):5'- ACCAAGGCAAGCTTAGTCTGG -3'

Sequencing Primer
(F):5'- CATTTTCAGGATGAGAAGCGAAAGG -3'
(R):5'- AAGCTTAGTCTGGGGCTAGCAC -3'
Posted On2015-04-17