Incidental Mutation 'R3748:Cmss1'
ID309948
Institutional Source Beutler Lab
Gene Symbol Cmss1
Ensembl Gene ENSMUSG00000022748
Gene Namecms small ribosomal subunit 1
Synonyms4930572F24Rik, 1110001A06Rik, 2610528E23Rik
MMRRC Submission 040733-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R3748 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57302000-57606864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57302272 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 253 (E253G)
Ref Sequence ENSEMBL: ENSMUSP00000110011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371]
Predicted Effect probably damaging
Transcript: ENSMUST00000114371
AA Change: E253G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748
AA Change: E253G

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,765,750 C14R probably benign Het
2310003L06Rik A G 5: 87,964,563 probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca13 T C 11: 9,316,119 probably benign Het
Acaca A G 11: 84,311,409 probably null Het
Adam2 C T 14: 66,059,912 V182I probably benign Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Csmd1 T G 8: 15,906,071 N3379H probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Golgb1 G C 16: 36,918,912 D2538H probably benign Het
Hoxc12 A G 15: 102,938,378 E235G probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mfsd4b4 A G 10: 39,894,136 probably benign Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nrp1 T C 8: 128,457,980 W369R probably damaging Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Olfr525 T C 7: 140,323,128 L143P possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Tdh T C 14: 63,495,993 T149A probably benign Het
Tnip3 C T 6: 65,614,763 L249F probably damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vmn2r27 T C 6: 124,230,392 I97V probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Cmss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cmss1 APN 16 57303729 missense probably damaging 0.99
R0031:Cmss1 UTSW 16 57311249 splice site probably null
R1231:Cmss1 UTSW 16 57316197 missense probably benign 0.14
R1556:Cmss1 UTSW 16 57316197 missense probably benign 0.14
R2017:Cmss1 UTSW 16 57316278 missense probably damaging 0.99
R4835:Cmss1 UTSW 16 57316182 nonsense probably null
R5316:Cmss1 UTSW 16 57302275 missense probably damaging 0.99
R5598:Cmss1 UTSW 16 57311286 missense probably damaging 1.00
R5987:Cmss1 UTSW 16 57302245 missense probably benign 0.40
R7145:Cmss1 UTSW 16 57311355 missense probably benign 0.19
R7664:Cmss1 UTSW 16 57317947 missense probably benign 0.00
R8377:Cmss1 UTSW 16 57307394 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ACAGTTGTCAAAGAATCCCCTC -3'
(R):5'- AACTCATGTTTTGCGCAGTACC -3'

Sequencing Primer
(F):5'- TTGTCAAAGAATCCCCTCGAGGC -3'
(R):5'- ATGTTTTGCGCAGTACCTCTCTC -3'
Posted On2015-04-17