Incidental Mutation 'R0382:Olfr1183'
ID30995
Institutional Source Beutler Lab
Gene Symbol Olfr1183
Ensembl Gene ENSMUSG00000049372
Gene Nameolfactory receptor 1183
SynonymsGA_x6K02T2Q125-49948903-49949814, MOR230-6
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88454867-88469199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88461725 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 147 (R147S)
Ref Sequence ENSEMBL: ENSMUSP00000154094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102618] [ENSMUST00000213115] [ENSMUST00000219871]
Predicted Effect probably benign
Transcript: ENSMUST00000102618
AA Change: R128S

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099678
Gene: ENSMUSG00000049372
AA Change: R128S

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 299 1.8e-5 PFAM
Pfam:7tm_1 38 284 1.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213115
AA Change: R147S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219871
AA Change: R128S

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Olfr1183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1183 APN 2 88461352 missense probably benign
IGL01150:Olfr1183 APN 2 88462075 missense possibly damaging 0.93
IGL02894:Olfr1183 APN 2 88461726 missense probably damaging 1.00
R0401:Olfr1183 UTSW 2 88461925 missense probably damaging 1.00
R0664:Olfr1183 UTSW 2 88462171 missense probably damaging 1.00
R1990:Olfr1183 UTSW 2 88461342 start codon destroyed probably null
R3122:Olfr1183 UTSW 2 88461509 missense probably damaging 0.99
R4596:Olfr1183 UTSW 2 88462194 missense probably benign 0.28
R7361:Olfr1183 UTSW 2 88461492 missense probably benign 0.28
R7469:Olfr1183 UTSW 2 88461347 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGATCATAGACGCCCTCTCGCAG -3'
(R):5'- GGCTCCAGATTCTTTTGGGTACACC -3'

Sequencing Primer
(F):5'- GCCCTCTCGCAGAAAAAAATTATTAC -3'
(R):5'- GTATCCATGCAGGCAAGTTTC -3'
Posted On2013-04-24