Incidental Mutation 'R3892:Clip2'
ID309975
Institutional Source Beutler Lab
Gene Symbol Clip2
Ensembl Gene ENSMUSG00000063146
Gene NameCAP-GLY domain containing linker protein 2
SynonymsWSCR4, Cyln2, CLIP-115
MMRRC Submission 040804-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134489383-134552434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134522993 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 92 (K92E)
Ref Sequence ENSEMBL: ENSMUSP00000098212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]
Predicted Effect probably damaging
Transcript: ENSMUST00000036999
AA Change: K92E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: K92E

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 457 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
coiled coil region 529 578 N/A INTRINSIC
coiled coil region 640 982 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100647
AA Change: K92E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: K92E

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 496 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
coiled coil region 564 613 N/A INTRINSIC
coiled coil region 675 1017 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202895
Meta Mutation Damage Score 0.4232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Bckdhb A C 9: 83,988,810 E124D probably damaging Het
Card6 T C 15: 5,099,296 T873A probably benign Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Ptprk A T 10: 28,263,621 Q114L probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sacs T G 14: 61,204,387 I1294R probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Vmn2r75 A T 7: 86,164,286 L436Q probably null Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Clip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Clip2 APN 5 134500157 splice site probably benign
IGL01024:Clip2 APN 5 134510212 missense probably damaging 1.00
IGL01103:Clip2 APN 5 134492350 missense possibly damaging 0.64
IGL01726:Clip2 APN 5 134522664 missense probably damaging 1.00
IGL01833:Clip2 APN 5 134498084 splice site probably benign
IGL02174:Clip2 APN 5 134494264 missense probably damaging 1.00
IGL02232:Clip2 APN 5 134503130 missense probably damaging 1.00
IGL02271:Clip2 APN 5 134502571 missense probably benign 0.35
IGL02471:Clip2 APN 5 134518022 missense probably benign 0.04
IGL02690:Clip2 APN 5 134510159 splice site probably benign
IGL03198:Clip2 APN 5 134498082 splice site probably benign
IGL03269:Clip2 APN 5 134516894 missense probably damaging 1.00
scissors UTSW 5 134517999 nonsense probably null
R0335:Clip2 UTSW 5 134535215 start gained probably benign
R0422:Clip2 UTSW 5 134498113 missense probably benign 0.04
R0519:Clip2 UTSW 5 134516151 missense probably benign 0.01
R1169:Clip2 UTSW 5 134492250 missense probably benign 0.36
R1642:Clip2 UTSW 5 134503253 missense possibly damaging 0.89
R1718:Clip2 UTSW 5 134502929 nonsense probably null
R1822:Clip2 UTSW 5 134503227 missense probably benign 0.01
R1824:Clip2 UTSW 5 134503227 missense probably benign 0.01
R2011:Clip2 UTSW 5 134503115 missense probably damaging 1.00
R3106:Clip2 UTSW 5 134523064 missense probably benign 0.12
R3890:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3891:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R4134:Clip2 UTSW 5 134492253 missense probably benign 0.08
R4237:Clip2 UTSW 5 134535197 start gained probably benign
R4239:Clip2 UTSW 5 134535197 start gained probably benign
R4294:Clip2 UTSW 5 134492313 missense probably benign 0.09
R4450:Clip2 UTSW 5 134502953 missense possibly damaging 0.82
R4741:Clip2 UTSW 5 134516269 missense probably benign 0.02
R5186:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5235:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5409:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5410:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5448:Clip2 UTSW 5 134514048 missense probably benign 0.01
R5900:Clip2 UTSW 5 134502779 missense possibly damaging 0.48
R6464:Clip2 UTSW 5 134491925 missense probably benign 0.00
R7032:Clip2 UTSW 5 134522630 missense probably damaging 1.00
R7152:Clip2 UTSW 5 134496241 missense probably damaging 1.00
R7216:Clip2 UTSW 5 134502917 missense probably benign 0.01
R7358:Clip2 UTSW 5 134502630 nonsense probably null
R7725:Clip2 UTSW 5 134517999 nonsense probably null
R8380:Clip2 UTSW 5 134502797 missense probably damaging 0.96
X0062:Clip2 UTSW 5 134503136 missense probably benign 0.12
Z1177:Clip2 UTSW 5 134516835 missense probably damaging 0.98
Z1177:Clip2 UTSW 5 134522999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCACCGAGTGCGTATC -3'
(R):5'- CAGGCTAGCTCTAATTCCTGC -3'

Sequencing Primer
(F):5'- TGCGTATCACTGCCCGAG -3'
(R):5'- GCCTCTTAACTTATCCACAGGG -3'
Posted On2015-04-17