Incidental Mutation 'R3892:Vmn2r75'
ID309983
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Namevomeronasal 2, receptor 75
SynonymsEG546981
MMRRC Submission 040804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86148042-86171724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86164286 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 436 (L436Q)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
Predicted Effect probably null
Transcript: ENSMUST00000167830
AA Change: L436Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: L436Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Bckdhb A C 9: 83,988,810 E124D probably damaging Het
Card6 T C 15: 5,099,296 T873A probably benign Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Ptprk A T 10: 28,263,621 Q114L probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sacs T G 14: 61,204,387 I1294R probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 86148032 unclassified probably benign
IGL01287:Vmn2r75 APN 7 86148593 missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 86165566 missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 86171662 nonsense probably null
IGL01406:Vmn2r75 APN 7 86163292 splice site probably benign
IGL01615:Vmn2r75 APN 7 86148473 missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 86164247 missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 86165578 missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 86165140 missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 86165766 missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 86148703 missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 86148436 missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 86171725 unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 86165583 missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0083:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 86148307 missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 86165080 missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 86165513 missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 86148241 nonsense probably null
R0631:Vmn2r75 UTSW 7 86163270 missense probably null 1.00
R0661:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0811:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 86164268 missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 86148590 missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 86165642 missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 86148811 missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 86148262 missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 86165164 missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 86148936 missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 86148421 missense probably damaging 0.99
R4532:Vmn2r75 UTSW 7 86148141 nonsense probably null
R4583:Vmn2r75 UTSW 7 86164082 missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 86166286 missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 86163170 missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 86148403 missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 86171579 missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 86165497 missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 86166167 critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 86165527 missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 86164164 missense probably benign
R5156:Vmn2r75 UTSW 7 86164228 missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 86164239 missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 86166292 missense probably benign
R5574:Vmn2r75 UTSW 7 86166302 missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 86148494 missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 86171571 missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 86165370 missense probably benign
R6021:Vmn2r75 UTSW 7 86171612 missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 86166167 critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 86165274 missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 86171576 missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 86164079 missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 86164245 missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 86148436 missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 86166360 missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCTGTTGACCACTTGGAAG -3'
(R):5'- CCTGTGATCAAATAACACTATTGGC -3'

Sequencing Primer
(F):5'- GCTGTTGACCACTTGGAAGATAACC -3'
(R):5'- CACTATTGGCAGTTAAAACACAGAG -3'
Posted On2015-04-17