Incidental Mutation 'R3892:Bckdhb'
ID309991
Institutional Source Beutler Lab
Gene Symbol Bckdhb
Ensembl Gene ENSMUSG00000032263
Gene Namebranched chain ketoacid dehydrogenase E1, beta polypeptide
Synonyms
MMRRC Submission 040804-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location83925145-84124240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83988810 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 124 (E124D)
Ref Sequence ENSEMBL: ENSMUSP00000139684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034801] [ENSMUST00000190166] [ENSMUST00000190637]
Predicted Effect probably damaging
Transcript: ENSMUST00000034801
AA Change: E56D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034801
Gene: ENSMUSG00000032263
AA Change: E56D

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 312 1.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190166
AA Change: E56D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140598
Gene: ENSMUSG00000032263
AA Change: E56D

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 309 3.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190637
AA Change: E124D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139684
Gene: ENSMUSG00000032263
AA Change: E124D

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Transket_pyr 69 244 4.92e-60 SMART
Pfam:Transketolase_C 259 377 1.1e-37 PFAM
Meta Mutation Damage Score 0.9703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes the beta chain of the branched chain alpha ketoacid dehydrogenase (Bckdh) complex. The encoded protein exists in a heterotetrameric complex containing the Bckdh alpha subunit to form the E1 catalytic component of Bckdh complex. The Bckdh complex catalyzes the oxidative decarboxylation of branched chain ketoacids to their corresponding acyl-CoA esters, during the catabolism of leucine, isoleucine and valine. In humans, certain mutations in this gene cause maple syrup urine disease. Alternative splicing results in multiple transcript variants encoding different isoforms. A pseudogene for this gene has been identified. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Card6 T C 15: 5,099,296 T873A probably benign Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Ptprk A T 10: 28,263,621 Q114L probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sacs T G 14: 61,204,387 I1294R probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Vmn2r75 A T 7: 86,164,286 L436Q probably null Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Bckdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Bckdhb APN 9 83991736 missense probably benign
IGL02537:Bckdhb APN 9 83989141 missense probably benign 0.07
IGL02808:Bckdhb APN 9 83988845 missense probably benign 0.05
R0608:Bckdhb UTSW 9 83953736 missense probably damaging 1.00
R1780:Bckdhb UTSW 9 83953783 critical splice donor site probably null
R4825:Bckdhb UTSW 9 83988905 missense probably damaging 1.00
R6018:Bckdhb UTSW 9 84069184 missense probably benign 0.41
R6823:Bckdhb UTSW 9 83953761 missense possibly damaging 0.76
R7350:Bckdhb UTSW 9 84010326 missense possibly damaging 0.93
R7383:Bckdhb UTSW 9 83953713 missense possibly damaging 0.66
R7759:Bckdhb UTSW 9 84010326 missense probably damaging 0.96
R8269:Bckdhb UTSW 9 84122364 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGATTTGCCTCTCAGACTG -3'
(R):5'- TGGACAACAATTGCTGAAGGC -3'

Sequencing Primer
(F):5'- AGCCAGTTTGCTGTTTACTGTTGC -3'
(R):5'- CTGAGTGGGAGGAGCCAGC -3'
Posted On2015-04-17