Incidental Mutation 'R3892:Rcbtb1'
ID310003
Institutional Source Beutler Lab
Gene Symbol Rcbtb1
Ensembl Gene ENSMUSG00000035469
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms
MMRRC Submission 040804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59201209-59237265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59228355 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 382 (H382Q)
Ref Sequence ENSEMBL: ENSMUSP00000037030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022551] [ENSMUST00000043227] [ENSMUST00000172810] [ENSMUST00000174009]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022551
AA Change: H382Q

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022551
Gene: ENSMUSG00000035469
AA Change: H382Q

DomainStartEndE-ValueType
Pfam:RCC1 40 89 3.9e-8 PFAM
Pfam:RCC1 93 143 2e-13 PFAM
Pfam:RCC1_2 130 159 5.7e-12 PFAM
Pfam:RCC1 146 196 2.2e-13 PFAM
Pfam:RCC1_2 183 212 3.2e-8 PFAM
Pfam:RCC1 199 248 5.3e-17 PFAM
Pfam:RCC1_2 235 264 2.2e-11 PFAM
Pfam:RCC1 251 300 2.3e-15 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043227
AA Change: H382Q

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037030
Gene: ENSMUSG00000035469
AA Change: H382Q

DomainStartEndE-ValueType
Pfam:RCC1 40 88 3.2e-7 PFAM
Pfam:RCC1 93 143 2.6e-13 PFAM
Pfam:RCC1_2 130 159 3.7e-12 PFAM
Pfam:RCC1 146 196 3.8e-14 PFAM
Pfam:RCC1_2 183 212 6.5e-8 PFAM
Pfam:RCC1 199 248 1.3e-16 PFAM
Pfam:RCC1_2 235 264 3.5e-10 PFAM
Pfam:RCC1 251 300 1.2e-13 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153225
Predicted Effect probably benign
Transcript: ENSMUST00000172810
Predicted Effect probably benign
Transcript: ENSMUST00000174009
Predicted Effect probably benign
Transcript: ENSMUST00000174830
SMART Domains Protein: ENSMUSP00000133421
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 1 48 2e-12 PFAM
Pfam:RCC1_2 33 64 4.8e-13 PFAM
Pfam:RCC1 51 93 7.8e-13 PFAM
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal RCC1 domain and a C-terminal BTB (broad complex, tramtrack and bric-a-brac) domain. In rat, over-expression of this gene in vascular smooth muscle cells induced cellular hypertrophy. In rat, the C-terminus of RCBTB1 interacts with the angiotensin II receptor-1A. In humans, this gene maps to a region of chromosome 13q that is frequently deleted in B-cell chronic lymphocytic leukemia and other lymphoid malignancies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Bckdhb A C 9: 83,988,810 E124D probably damaging Het
Card6 T C 15: 5,099,296 T873A probably benign Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Ptprk A T 10: 28,263,621 Q114L probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sacs T G 14: 61,204,387 I1294R probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Vmn2r75 A T 7: 86,164,286 L436Q probably null Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Rcbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Rcbtb1 APN 14 59228305 missense probably benign 0.19
IGL01954:Rcbtb1 APN 14 59229967 missense probably damaging 1.00
IGL02458:Rcbtb1 APN 14 59229994 missense probably damaging 1.00
IGL02632:Rcbtb1 APN 14 59224682 missense probably damaging 0.99
IGL02689:Rcbtb1 APN 14 59224700 missense probably damaging 1.00
IGL03201:Rcbtb1 APN 14 59223278 missense probably damaging 1.00
IGL03411:Rcbtb1 APN 14 59209970 start codon destroyed probably null 1.00
R0014:Rcbtb1 UTSW 14 59235242 missense probably benign 0.35
R2858:Rcbtb1 UTSW 14 59221412 splice site probably null
R2877:Rcbtb1 UTSW 14 59210592 splice site probably benign
R3890:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3945:Rcbtb1 UTSW 14 59224776 critical splice donor site probably null
R6869:Rcbtb1 UTSW 14 59217602 missense probably benign 0.01
R7224:Rcbtb1 UTSW 14 59228379 missense probably damaging 1.00
R7910:Rcbtb1 UTSW 14 59236678 missense unknown
R7962:Rcbtb1 UTSW 14 59221567 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGGTTTGTCAACTGAGTCATGAAC -3'
(R):5'- TCCTGGGTAACGAGCAGTAAC -3'

Sequencing Primer
(F):5'- GACGCCATAATTATCTTTTGGAGGCC -3'
(R):5'- CCTGGGTAACGAGCAGTAACTATCTG -3'
Posted On2015-04-17