Incidental Mutation 'R3892:Card6'
ID310008
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
MMRRC Submission 040804-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5099296 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 873 (T873A)
Ref Sequence ENSEMBL: ENSMUSP00000112833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365]
Predicted Effect probably benign
Transcript: ENSMUST00000118365
AA Change: T873A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: T873A

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Meta Mutation Damage Score 0.1345 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Bckdhb A C 9: 83,988,810 E124D probably damaging Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Ptprk A T 10: 28,263,621 Q114L probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sacs T G 14: 61,204,387 I1294R probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Vmn2r75 A T 7: 86,164,286 L436Q probably null Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
Mark UTSW 15 5098691 small deletion probably benign
sharps UTSW 15 5099896 nonsense probably null
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R4408:Card6 UTSW 15 5101054 missense probably damaging 0.97
R4856:Card6 UTSW 15 5105141 splice site probably null
R4886:Card6 UTSW 15 5105141 splice site probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5518:Card6 UTSW 15 5105214 missense probably damaging 0.99
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7720:Card6 UTSW 15 5098423 missense unknown
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R7977:Card6 UTSW 15 5100525 missense probably damaging 1.00
R7987:Card6 UTSW 15 5100525 missense probably damaging 1.00
R8295:Card6 UTSW 15 5098691 small deletion probably benign
R8303:Card6 UTSW 15 5105365 missense probably benign 0.13
R8431:Card6 UTSW 15 5100276 missense probably damaging 0.98
R8691:Card6 UTSW 15 5099596 missense possibly damaging 0.76
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTCTGAGAAGGCACGGGTTG -3'
(R):5'- CAGGCAGATGTCCAGAACTC -3'

Sequencing Primer
(F):5'- CTGGGAGGTAGATGAAAGTTTACTCC -3'
(R):5'- GCAGATGTCCAGAACTCTTGAG -3'
Posted On2015-04-17