Mutagenetix > Incidental Mutations

Incidental Mutation 'R3892:Zfp407'

310015

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

040804-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3892 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84560352 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 879 (V879I)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably damaging
Transcript: ENSMUST00000125763
AA Change: V879I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: V879I

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182297

Meta Mutation Damage Score

0.1021

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	T	A	10: 50,842,193	I1994N	probably damaging	Het
BC061237	A	G	14: 44,501,273	D43G	probably benign	Het
Bckdhb	A	C	9: 83,988,810	E124D	probably damaging	Het
Card6	T	C	15: 5,099,296	T873A	probably benign	Het
Cbs	C	A	17: 31,616,074	C476F	probably benign	Het
Cckbr	A	C	7: 105,426,169	T49P	probably benign	Het
Cd248	C	T	19: 5,069,506	P461S	probably damaging	Het
Cdh16	T	C	8: 104,616,327	Y19C	probably damaging	Het
Clip2	T	C	5: 134,522,993	K92E	probably damaging	Het
Cnnm2	T	A	19: 46,761,793	C7*	probably null	Het
Ctnnb1	T	G	9: 120,950,514		probably benign	Het
Def8	T	C	8: 123,458,344		probably benign	Het
Deup1	A	G	9: 15,599,713	Y257H	probably damaging	Het
Diaph1	C	A	18: 37,900,638		probably benign	Het
Dmrta1	A	T	4: 89,691,594	I264F	possibly damaging	Het
Dnah12	A	G	14: 26,856,616	M491V	probably benign	Het
Eftud2	A	C	11: 102,846,187	I590S	probably damaging	Het
Ep300	T	C	15: 81,619,997		probably benign	Het
Fam209	A	G	2: 172,472,698	K36E	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Flg	A	T	3: 93,279,526	Q95L	probably benign	Het
Gabrr2	A	G	4: 33,081,348	Y4C	probably damaging	Het
Ggcx	G	A	6: 72,418,372	V149M	probably damaging	Het
Gm10801	T	G	2: 98,663,901		probably null	Het
H2-M10.1	T	A	17: 36,324,389	Q250L	possibly damaging	Het
Hecw2	A	T	1: 53,926,121	N515K	probably benign	Het
Hmcn1	A	T	1: 150,635,195	D3592E	probably damaging	Het
Klf5	T	A	14: 99,299,073	F27I	probably benign	Het
Krt1	T	A	15: 101,850,412	S106C	unknown	Het
Lrrc14b	T	C	13: 74,363,668	S98G	probably benign	Het
Lrrc7	A	G	3: 158,160,696	V1136A	probably benign	Het
Map3k11	G	T	19: 5,702,283	C831F	probably benign	Het
Mccc2	T	C	13: 99,967,733	T303A	probably benign	Het
Mipep	T	C	14: 60,808,995	L322P	probably damaging	Het
Mob1b	T	A	5: 88,753,202	I156K	probably damaging	Het
Myd88	T	C	9: 119,337,816	D225G	possibly damaging	Het
Nos1ap	T	C	1: 170,349,456	Y126C	probably damaging	Het
Nuak2	G	T	1: 132,331,485	A342S	possibly damaging	Het
Olfr1309	A	C	2: 111,983,141	M311R	probably benign	Het
Olfr58	T	G	9: 19,783,715	I194S	probably benign	Het
Olfr718-ps1	G	T	5: 143,137,397	S290R	probably benign	Het
Pcdhb16	A	T	18: 37,479,369	I461F	probably benign	Het
Pcdhga10	A	C	18: 37,749,481	H765P	probably benign	Het
Plxna4	C	A	6: 32,215,654	D791Y	probably damaging	Het
Pole	T	G	5: 110,336,439	I320M	probably damaging	Het
Psg23	G	T	7: 18,612,041	T243N	probably damaging	Het
Ptma-ps1	A	G	7: 24,064,118		noncoding transcript	Het
Ptprk	A	T	10: 28,263,621	Q114L	probably benign	Het
Pum1	T	C	4: 130,764,082	L774P	probably damaging	Het
Rabgef1	A	G	5: 130,208,679		probably benign	Het
Rasef	A	G	4: 73,780,397	V9A	probably benign	Het
Rcbtb1	T	A	14: 59,228,355	H382Q	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Sacs	T	G	14: 61,204,387	I1294R	probably damaging	Het
Slc19a3	A	T	1: 83,022,957	F113Y	probably damaging	Het
Snrnp48	G	A	13: 38,217,389	S204N	possibly damaging	Het
Sp3	A	G	2: 72,979,032		probably benign	Het
St8sia6	G	A	2: 13,672,524	H161Y	probably benign	Het
Strip2	A	T	6: 29,917,075		probably benign	Het
Trank1	T	C	9: 111,364,759	V617A	probably benign	Het
Uvssa	T	A	5: 33,389,752	S221T	probably benign	Het
Vmn2r75	A	T	7: 86,164,286	L436Q	probably null	Het
Wdfy4	T	C	14: 33,047,280	E2076G	probably damaging	Het
Zmym4	A	G	4: 126,904,476	I786T	probably benign	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- CTAGCCTGTGCGTCAGAAAC -3'
(R):5'- AGTATGCTAACACCCAAGGAGC -3'

Sequencing Primer
(F):5'- TCAGAAACGGTCACTGCTAG -3'
(R):5'- AAGGAGCTTCCACAGTCTGGTG -3'

Posted On

2015-04-17